|
Status |
Public on Mar 20, 2020 |
Title |
Fraction_16 |
Sample type |
SRA |
|
|
Source name |
Clarified whole cell lysate
|
Organism |
Streptococcus pneumoniae |
Characteristics |
strain: TIGR4 growth phase: Mid-exponential (OD 0.5) genotype: wild type
|
Extracted molecule |
total RNA |
Extraction protocol |
Clarified lysates were centrifuged on a glycerol gradient, which was subsequently fractionated and the RNA extracted by P/C/I extraction. Input control was isolated using TRIzol reagent. RNA was fragmented, and the 3' TruSeq adapter ligated to the 3' end. Following cDNA synthesis, the 5' TruSeq adapter was ligated to the 3' end and the resulting cDNA amplified by PCR.
|
|
|
Library strategy |
RNA-Seq |
Library source |
transcriptomic |
Library selection |
cDNA |
Instrument model |
Illumina NextSeq 500 |
|
|
Data processing |
Sequenced reads were trimmed for adaptor sequence using cutadapt 1.10 with Python 3.5.2 . Command line parameters: -q 20 -m 1 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC Sequenced reads were mapped to NC_003028.3 Streptococcus pneumoniae TIGR4 genome using segemehl version 0.2.0-418 with Python version: 3.6.5. READemption tool version: 0.4.3 was used for this purpose. Command line parameter: reademption align -r -a 95 -l 20 --fastq Coverage files were generated using READemption tool version: 0.4.3. Command line parameter: reademption coverage Genome_build: NC_003028.3 Supplementary_files_format_and_content: wig
|
|
|
Submission date |
Oct 10, 2019 |
Last update date |
Mar 21, 2020 |
Contact name |
Konrad U. Förstner |
E-mail(s) |
foerstner@zbmed.de
|
Organization name |
ZB MED - Information Centre for Life Sciences
|
Department |
Information Services
|
Lab |
Förstner Lab
|
Street address |
Gleueler Str. 60
|
City |
Cologne |
State/province |
North Rhine-Westphalia |
ZIP/Postal code |
50931 |
Country |
Germany |
|
|
Platform ID |
GPL23797 |
Series (2) |
GSE138732 |
A census of RNA/protein complexes in a model Gram-positive bacterium reveals exonuclease-mediated sRNA activation in competence regulation |
GSE145605 |
Exonuclease-mediated sRNA activation in competence regulation in a Gram-positive bacterium |
|
Relations |
BioSample |
SAMN13013434 |
SRA |
SRX6976970 |