 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 31, 2022 |
| Title |
CoIP rep1 |
| Sample type |
SRA |
| |
|
| Source name |
whole bacterial cells
|
| Organism |
Caulobacter vibrioides |
| Characteristics |
strain: NA1000
genotype: 3xFLAG::hfq
growth phase: OD660=1
treatment: RNA coIP
|
| Treatment protocol |
Cells equivalent to 50 OD660 units were collected and subjected to RNA co-immunoprecipitation.
|
| Growth protocol |
C. crescentus NA1000 wild-type and 3xFLAG::hfq strains were cultivated in PYE medium to OD660 of 1.0
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated by phenol-chloroform extraction using standard protocols. Prepared RNA was digested with DNaseI. Integrity of the prepared RNA was tested using a Bioanalyzer.
cDNA libraries were prepared using the NEBNext Small RNA Library Prep Set for Illumina (NEB E7300), according to the manufacturer's instructions. Quality of the prepared libraries was tested using a Bioanalyzer.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
44A_S2_L001_R2_001
|
| Data processing |
Sequencing of the cDNA libraries was performed by Dr. Andreas Brachmann (LMU, munich, Parniske group)
cDNA reads were imported into CLC Genomics Workbench v11.0 and analysed using mostly standard parameters.
Adaptor- and quality trimming was performed using the trim reads command with the following settings: Sequence = GATCGTCGGACTGTAGAACTCTGAACGTGTAGA, Strand = Minus, Action = Remove adapter, Scores = Mismatch: 2, Gapcost: 3, Cutoff: 10, Cutoff at end: 4
The trimmed reads were checked for quality and mapped to the C.crescentus reference genome: NCBI Acc.number: NC_011916 using the following settings: Mismatch cost = 2, Insertion cost = 3, Deletion cost = 3, Length fraction = 0.8, Similarity fraction = 0.8, Global alignment = Yes, Strand specific = Reverse, Maximum number of hits for a read = 10
Reads mapping in CDS were counted, and genes with a total count cutoff of >10 in all samples were considered for analysis. Read counts were normalized (CPM), and transformed (log2). Differential expression was tested using the built in tool corresponding to edgeR in exact mode with tagwise dispersions. Genes with a fold-change of > 3.0 in either condition and a FDR adjusted p-value < 0.01 were considered to be differentially expressed.
Genome_build: NC_011916
Supplementary_files_format_and_content: Read count table and edgeR (exact mode) analysis
|
| |
|
| Submission date |
Apr 07, 2020 |
| Last update date |
Dec 31, 2022 |
| Contact name |
Kathrin Fröhlich |
| E-mail(s) |
kathrin.froehlich@uni-jena.de
|
| Organization name |
Friedrich-Schiller-Universität Jena
|
| Department |
Fakultät für Biowissenschaften, Bacterial RNA Biology
|
| Lab |
AG Fröhlich
|
| Street address |
Winzerlaer Straße 2
|
| City |
Jena |
| State/province |
Thuringia |
| ZIP/Postal code |
07745 |
| Country |
Germany |
| |
|
| Platform ID |
GPL21016 |
| Series (2) |
| GSE148206 |
RNA co-immunoprecipitation with 3xFLAG::Hfq in Caulobacter crescentus |
| GSE148211 |
To be updated |
|
| Relations |
| BioSample |
SAMN14548592 |
| SRA |
SRX8073076 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
