 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 31, 2022 |
| Title |
R0199 rep3 |
| Sample type |
SRA |
| |
|
| Source name |
whole bacterial cells
|
| Organism |
Caulobacter vibrioides |
| Characteristics |
strain: NA1000
genotype: pKF482 (pBVMCS-6-R0199)
growth phase: OD660=0.8
treatment: 0.5 mM vanillate
|
| Treatment protocol |
Cells were harvested in tubes containing 1/5 vol. "stop-mix" (95% ethananol, 5% phenol) and snap frozen in liquid nitrogen until further processing.
|
| Growth protocol |
C. crescentus NA1000 carrying either pBVMCS-6 (empty vector control) or pKF482 (pBVMCS-6 with R0199) were grown in M2 medium (+ 0.2% glucose; supplemented with chloramphenicol) to OD660=0.8, when expression from the vanillate-inducible promoter was activated by addition of 0.5 mM vanillate. Cells were harvested 15 minutes post induction.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was isolated using the HotPhenol method according to standard protocols. Prepared RNA was digested with DNaseI and cleaned up by phenol-chloroform extraction. Ribosomal RNA was depleted with the Ribo-Zero kit (Epicentre) for Gram-negative bacteria. Integrity of the prepared RNA was tested using a Bioanalyzer.
Directional cDNA libraries were prepared using the NEBNext Ultra II Directional RNA Libary Prep Kit for Illumina (NEB E7760) according to the manufacturer's instructions. Quality of the prepared libraries was tested using a Bioanalyzer.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 1500 |
| |
|
| Description |
R199_3_ATTCCT
|
| Data processing |
Sequencing of the cDNA libraries was performed by the LAFUGA service unit (Gene Center, munich, Blum group)
cDNA reads were imported into CLC Genomics Workbench v11.0 and analysed using mostly standard parameters.
3'adaptor- and quality trimming was performed using the trim reads command with the following settings: Sequence = TGACTGGAGTTCAGACGTGTGCTCTTCCGATCT, Strand = Minus, Action = Remove adapter, Scores = Mismatch: 2, Gapcost: 3, Cutoff: 10, Cutoff at end: 4
The trimmed reads were checked for quality and mapped to the C. crescentus NA1000 reference genome; NCBI Acc.number: NC_011916 using the following settings: Mismatch cost = 2, Insertion cost = 3, Deletion cost = 3, Length fraction = 0.8, Similarity fraction = 0.8, Global alignment = Yes, Strand specific = Reverse, Maximum number of hits for a read = 1
Reads mapping in CDS were counted, and genes with a total count cutoff of >10 in all samples were considered for analysis. Read counts were normalized (CPM), and transformed (log2). Differential expression was tested using the built in tool corresponding to edgeR in exact mode with tagwise dispersions. Genes with a fold-change of > 2.0 in either condition and a FDR adjusted p-value < = 0.05 were considered to be differentially expressed.
Genome_build: NC_011916
Supplementary_files_format_and_content: Read count table and edgeR (exact mode) analysis
|
| |
|
| Submission date |
Apr 07, 2020 |
| Last update date |
Dec 31, 2022 |
| Contact name |
Kathrin Fröhlich |
| E-mail(s) |
kathrin.froehlich@uni-jena.de
|
| Organization name |
Friedrich-Schiller-Universität Jena
|
| Department |
Fakultät für Biowissenschaften, Bacterial RNA Biology
|
| Lab |
AG Fröhlich
|
| Street address |
Winzerlaer Straße 2
|
| City |
Jena |
| State/province |
Thuringia |
| ZIP/Postal code |
07745 |
| Country |
Germany |
| |
|
| Platform ID |
GPL28356 |
| Series (2) |
|
| Relations |
| BioSample |
SAMN14548610 |
| SRA |
SRX8073089 |
| Supplementary data files not provided |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
|
|
|
|
 |
