|
| Status |
Public on Jun 17, 2020 |
| Title |
dNET-seq Late S2P replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
Whole embryos
|
| Organism |
Drosophila melanogaster |
| Characteristics |
developmental stage: 4-6 hours post-fertilisation
net-seq antibody: anti-Pol II CTD S2P (ab5095 Abcam)
tissue: whole embryo
|
| Growth protocol |
Drosophila melanogaster flies (Oregon R (OrR) strain) were raised at 25°C. Embryos were collected into apple juice-agar plates supplemented with fresh yeast.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Embryos were harvested from the plates, dechorionated in 50% bleach solution and washed prior to flash freeazing in liquid nitrogen. Lysates from frozen embryos were obtained and chromatin was precipitated. Chromatin was digested with MNase and DNA-RNA-Pol II complexes were immunoprecipitated with antibodies. 5' ends were phosphorylated using T4 PNK 3′phosphatase minus and RNA fragments were isolated and using Quick-RNA MicroPrep (Zymo research)
Libraries were prepared following the standard protocol of the Truseq small RNA library prep kit (Illumina). Libraries were PCR amplified using 16 PCR cycles and cDNA libraries were fractionated in the gel between 130 to 300bp
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Description |
nascent RNA
|
| Data processing |
Library strategy: dNET-seq
Adapter sequences were removed from all dNET-seq paired-end samples using Cutadapt (version 1.18) with the following parameters: -a TGGAATTCTCGGGTGCCAAGG -A GATCGTCGGACTGTAGAACTCTGAAC -m 10 -e 0.05 --match-read-wildcards -n 1.
Paired-end read merging was performed using bbmerge.sh from BBMap with the ‘xloose’ parameter.
Merged reads were then aligned to the Drosophila reference genome (dm6; Ensembl release 95) using STAR (version 2.6.0b) with –chimSegmentMin set to 20. Only uniquely mapped reads were considered, extracted using SAMtools (version 1.7) with -q set to 255.
PCR internal priming events generated during library preparation were removed using a custom Python script.
Single-nucleotide peaks for detecting splicing intermediate and intron lariat reads were called using a custom Python script (https://github.com/kennyrebelo).
Peaks of variable size for detecting putative pause sites were called using custom Python code (https://github.com/rosinaSav).
Custom Python code (https://github.com/rosinaSav) was used to randomise the coordinates of reads whilst preserving nucleotide compositon around the 5' end of the read. (The resulting peaks have been uploaded in the file NET_Dros_emb_4-6h_S5P_rep1_sorted_MNase_control_peaks_0.01_5_5_5_3_5_with_ups_intron.bed).
Genome_build: dm6.18
Supplementary_files_format_and_content: BED files for peaks and bigWig files for aligned reads.
|
| |
|
| Submission date |
Jun 16, 2020 |
| Last update date |
Jun 17, 2020 |
| Contact name |
Maria Carmo-Fonseca |
| E-mail(s) |
carmo.fonseca@medicina.ulisboa.pt
|
| Organization name |
Instituto de Medicina Molecular
|
| Lab |
Carmo-Fonseca
|
| Street address |
Av. Egas Moniz
|
| City |
Lisbon |
| ZIP/Postal code |
1649-028 |
| Country |
Portugal |
| |
|
| Platform ID |
GPL23702 |
| Series (1) |
| GSE152585 |
Dynamic properties of transcription and co-transcriptional splicing during early stages of Drosophila development |
|
| Relations |
| BioSample |
SAMN15249343 |
| SRA |
SRX8555713 |
