GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM4803138

Query DataSets for GSM4803138

Status

Public on Dec 10, 2020

Title

disome-seq-3AT_rep1

Sample type

SRA

Source name

Yeast

Organism

Saccharomyces cerevisiae

Characteristics

treatment: 3-AT
strain: S288C

Treatment protocol

For experiments using the 3-AT treatment, the strain S288C was cultivated at 30ºC in the SC−His+3-AT medium (synthetic complete medium with histidine dropped-out and 100 mM 3-AT added)

Growth protocol

The laboratory strain BY4742 (MATα his3Δ1 leu2Δ0 lys2Δ0 uraΔ0) was cultivated at 30ºC in the rich medium YPD (1% yeast extract, 2% peptone, and 2% dextrose).

Extracted molecule

polyA RNA

Extraction protocol

Ribosomes were extracted with the polysome lysis buffer (PLB), which contained 200 mM Tris-HCl (pH 8.0), 200 mM KCl, 35 mM MgCl2, 1% (v/v) Triton X-100, 5 mM DTT, and 50 µg/mL cycloheximide.
50000 units (A260) of ribosome dissolved in the PLB buffer were treated with 750 U RNase I (Ambion, AM2294) at 25°C for 2 hours. Our pilot experiments, as well as previous studies, have shown that polysome profiling is not necessary as long as the digestion with RNase I is complete; rather, this step consumes a large amount of ribosome (especially disome) samples. The following-up computational analyses can help to tell if the RNA fragments being collected are largely protected by ribosomes: whether the fragments are restricted to the coding sequences, whether the fragments are enriched in certain sizes, and whether a 3-nt periodicity exists . Therefore, RNA was directly extracted from the enzyme reaction system with hot phenol and was separated on a 17% (w/v) 7 M urea denaturing polyacrylamide gel in a 0.5×Tris-borate-EDTA (TBE) electrophoresis buffer. RNA fragments with the length of 25-30 nts or 50-80 nts were extracted by gel crushing and further incubated with an RNA gel extraction buffer (300 mM NaOAc pH 5.2, 10 mM Tris-HCl pH 8.0, 1 mM EDTA pH 8.0) overnight. The purified extracted RNA fragments for monosome-seq, disomes-seq, and mRNA-seq were subjected to small RNA library construction for Illumina sequencing (Gnomegen, k02420). The 5′-RNA adaptor contained a 3-nt random sequence at the 3′-end to avoid biased ligation. Monosome and disome footprints were sequenced with single-end 50 and paired-end 100 modes on BGISEQ-500 (BGI Group), respectively. The lengths of RNA fragments protected by single ribosomes peaked at 28-nt, consistent with previous studies.

Library strategy

OTHER

Library source

transcriptomic

Library selection

other

Instrument model

BGISEQ-500

Description

disome.3at.read_55-65nt.txt

Data processing

Library strategy: Ribo-Seq (ribosome profiling)
Sequenced reads were trimmed for adaptor sequence. The 3-nt random sequence at the 5'-end of each sequencing read was removed(, except for the two disome-seq-3AT libraries). The removed 3-nt sequence was added to the head of each read in the fastq format as the UMI, which can serve to remove PCR duplications generated during Illumina library preparation. The sequence identical to the 3'-sequencing adaptor (AGATCGGAAGAGCACACGTCT for read 1 in both disome-seq libraries and the disome-seq_negative_control; TGGAATTCTCGGGTGCCAAG for all eight monosome-seq and mRNA-seq libraries) was also trimmed in each read using cutadapt V1.16. The trimmed reads were mapped against rRNA with bowtie V1.2.2 with default parameters, and the mapped reads were filtered to avoid rRNA contamination. The rest reads were aligned against SGD R64-1-1 coding sequences with the --no-novel-juncs parameter using Tophat V2.1.1.
Genome_build: SGD R64-1-1
Supplementary_files_format_and_content: tab-delimited text files include read number for each Sample

Submission date

Sep 25, 2020

Last update date

Dec 30, 2020

Contact name

Yan-Ming Chen

E-mail(s)

ymchen@genetics.ac.cn

Organization name

Institute of Genetics and Developmental Biology Chinese Academy of Sciences

Street address

Beichen West Rd.