 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 30, 2021 |
| Title |
Library 2 with Rho DNA plasmid pool |
| Sample type |
SRA |
| |
|
| Source name |
Bacterial culture
|
| Organism |
Escherichia coli |
| Characteristics |
tissue: none
strain: DH5a
age: none
|
| Growth protocol |
Retinas were isolated from P0 newborn CD-1 mice and electroporated in a solution with 30 micrograms library and 30 micrograms Rho-GFP as described previously (Hsiau et al., 2007; Hughes et al., 2018; Kwasnieski et al., 2012; White et al., 2013, 2016). Electroporated retinas were cultured for eight days, at which point they were harvested, washed three times with HBSS (Gibco), and stored in TRIzol (Invitrogen) at -80C. Five retinas were pooled for each biological replicate and three replicates were performed for each experiment.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Target library reporter sequences were amplified using primers 'CACCTGTTCCTGTAGGCATGC' and 'TATTACAATTGTAGCCAGAAGTCAGATGCTCAAG' for 6 cycles at an annealing temperature of 66C followed by 18 cycles with no annealing step (NEB Phusion) and then purified with the Monarch PCR kit (NEB). PCR amplicons were digested using MfeI-HF and SphI-HF (NEB) and ligated to custom annealed adaptors with PE2 indexing barcodes and phased P1 barcodes. The final enrichment PCR used primers 'AATGATACGGCGACCACCGAG' and 'CAAGCAGAAGACGGCATACGA' for 20 cycles at an annealing temperature of 66C (NEB Phusion), followed by purification with the Monarch PCR kit. Samples were mixed at equal concentration and sequenced on the Illumina NextSeq platform.
RNA was extracted from TRIzol according to manufacturer instructions and treated with TURBO DNase (Invitrogen). cDNA was prepared using SuperScript RT III (Invitrogen) with oligo dT primers.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
Demultiplexing barcode sequence of 'ATAGTGGACA' upstream of a spacer sequence 'CATGC' followed by a 9 bp barcode for library elements
|
| Data processing |
Library strategy: Massively Parallel Reporter Assay
All raw reads were processed regardless of quality score. Reads with the expected in-line multiplexing barcode for each sample followed by the spacer sequence were identified. Demultiplexed reads were then used to determine the number of unique occurances of 9 bp sequences in the barcoded region of the reporter construct. Barcodes that exactly matched designed sequences were written to file along with the sequence identifier and the barcode's count. All other reads and barcodes were discarded.
Genome_build: mm10
Supplementary_files_format_and_content: First column contains unique 9 bp barcode, second column contains sequence identifier, third column contains number of reads with the corresponding barcode. Sequences were named using the following nomenclature: "chrom-start-stop_annotations_variant". "Chrom", "start", and "stop" correspond to the mm10 genomic coordinates of the sequences in BED format. "Annotations" is a four letter string where the first position indicates CRX binding status ("C" ChIP-seq peak or "U" Unbound), the second position indicates CRX motif status ("P" PWM hit, "S" Shape motif, or "B" Both PWM and shape motif), the third position indicates ATAC-seq status ("R" peak in Rods but not cones, "C" peak in Cones but not rods, "P" peak in both rod and cone Photoreceptors, or "N" peak in None of the above), and the fourth position indicates histone ChIP-seq status ("E" Enhancer marked with H3K27Ac+H3K4me3-, "P" Promoter marked with H3K27Ac+H3K4me3+, "Q" H3K27Ac-H3K4me3+, or "N" Neither mark). "Variant" indicates whether the sequence is genomic ("WT"), mutated CRX sites ("MUT-allCrxSites"), scrambled shape motif ("MUT-shape"), or a scrambled control ("scrambled").
|
| |
|
| Submission date |
Jan 29, 2021 |
| Last update date |
Jan 31, 2021 |
| Contact name |
Michael Aaron White |
| E-mail(s) |
mawhite@wustl.edu
|
| Organization name |
Washington University School of Medicine
|
| Department |
Genetics
|
| Street address |
4515 McKinley Ave, Campus Box 8510
|
| City |
St. Louis |
| State/province |
MO |
| ZIP/Postal code |
63110 |
| Country |
USA |
| |
|
| Platform ID |
GPL21222 |
| Series (1) |
| GSE165812 |
Information Content Differentiates Enhancers From Silencers in Mouse Photoreceptors |
|
| Relations |
| BioSample |
SAMN17695241 |
| SRA |
SRX9977720 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5050456_library2RhoPlasmid.counts.txt.gz |
236.0 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
