GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5359803

Query DataSets for GSM5359803

Status

Public on Oct 20, 2022

Title

ChIP-Seq Input from EGFP-KD

Sample type

SRA

Source name

EGFP-KD OSC

Organism

Drosophila melanogaster

Characteristics

cell type: Ovarian Somatic Cells (OSC)
treatment: RNAi EGFP
tissue: n/a
genotype: n/a

Growth protocol

Cells were grown at 26 degrees on OSC medium (Fly Extract added M3 medium).

Extracted molecule

genomic DNA

Extraction protocol

ChIP experiments of Ty1-tagged Mod(mdg4) isoforms are performed by truChIP Chromatin Shearing Kit according to manufactures instruction with minor modifications. 2x107 OSC were fixed with 1% formaldehyde 10min and quenched and lysed with buffers of truChIP Chromatin Shearing Kit. Fixed chromatin is sheered with Bioruptor II (BMbio BR2012A) for 20 cycles of 30s ON/30s OFF, high settings. Sheered chromatin is immunoprecipitated by antibody-conjugated Dynabeads protein G for 2hr. Immunoprecipitated chromatin was incubated with Proteinase K and RNase, and de-crosslinked at 65°C overnight.
For ChIP experiments of RNA polymerase II, 2x107 OSC were fixed with 1% formaldehyde 10min and quenched with final 0.1M Glycine for 5min. After twice wash with PBS, nuclei were isolated with 1ml of swelling buffer (25mM HEPES-KOH(pH 7.5), 1.5mM MgCl2, 10mM KCl, 0.1% NP-40, 1mM DTT and 1x Protease Inhibitor). Isolated nuclei were lysed in 400µl of sonication buffer(50mM HEPES-KOH(pH 7.4), 140mM NaCl, 1mM EDTA, 1% Triton X-100, 0.1% Na-deoxycholate, 0.1% SDS and 1xProtease Inhibitor) and were sheered with Bioruptor II (BMbio BR2012A) for 20 cycles of 30s ON/30s OFF, high settings. 3µg of antibody were incubated with chromatin for overnight. Next day, 20µl of Dynabeads M-280 Sheep anti-Mouse IgG is added to sample and incubated for 1hr. Beads were washed and treated with Proteinase K and RNase as described (Haring et al., 2007). DNA was purified with isopropanol precipitation using Pellet Paint NF Co-precipitant (Merck: 70748).
Fragments from the ChIP experiment were sheared to ∼200 bases using Covaris S220. These were used for library preparation with the NEBNext Ultra II DNA Library Prep Kit for Illumina (NEB) following the manufacturer’s protocol.

Library strategy

ChIP-Seq

Library source

genomic

Library selection

ChIP

Instrument model

HiSeq X Ten

Description

Sample 22
pol_E1.sort.bw

Data processing

RNA-Seq: Reads of mRNA were mapped to dm6 by RSEM and STAR using following parameter (rsem-calculate-expression --paired-end -p 8 --star --star-path ~/anaconda3/bin --gzipped-read-file). DEG were detected by limma. For analysis of transposable elements, reads were mapped to dm6 using following parameter (--runMode genomeGenerate --genomeDir ${path_to_index} --genomeSAindexNbases 12 --genomeFastaFiles ${path_to_fasta}).
ChIP-Seq: Adaptors added by NEBNext Ultra II were cut by cutadapt using following parameters (cutadapt -j 12 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -m 20 -o trim/${name2}_R1_trim.fastq.gz -p trim/${name2}_R2_trim.fastq.gz raw_file/${name2}_R1.fastq.gz raw_file/${name2}_R2.fastq.gz). For mapping to the genome, subsequent reads were mapped to the dm6 by bowtie2 using following parameters (bowtie2 -p 16 -x ${reference}/dm6 -N 1 -1 trim/${name2}_R1_trim.fastq.gz -2 trim/${name2}_R2_trim.fastq.gz -S sam_file/${name2}.sam). Peak call is performed by MACS using following parameter: for Mod(mdg4) isoforms(macs2 callpeak -t merge_file/Ty-AF_merge.sort.bam -c bam_file/Input-AF.sort.bam -n Ty-AF -f BAM -q 1e-15 -g dm --outdir peakcall_strict) and for PolII(macs2 callpeak -t ${item} -c ../bam_file/Input_All.sort.bam -n ${item%%.bam} -f BAM -g dm --outdir ../peakcall).
Micro-C XL: Distiller (https://github.com/open2c/distiller-nf) pipeline is used to process Micro-C datasets. First, sequencing reads were mapped to dm6 using bwa mem with flags-SP. Second, mapped reads were parsed and classified using the pairtools package (https://github.com/open2c/pairtools) to get cool file. PCR and/optical duplicates removed by matching the positions of aligned reads with 2bp flexibility. Next, pairs were filtered using mapping quality scores (MAPQ > 30) on each side of aligned chimeric read, binned into multiple resolutions and low coverage bins are removed. Finally multiresolution cooler files were created using the cooler package (https://github.com/open2c/cooler.git)(Abdennur and Mirny, 2019). We normalized contact matrices using the iterative correction procedure(Imakaev et al., 2012).
Genome_build: dm6
Supplementary_files_format_and_content: RNA-Seq: TPM and FPKM of each genes (flybase ID)
Supplementary_files_format_and_content: ChIP-Seq: bigwig file
Supplementary_files_format_and_content: Micro-C XL: multi-resolution cooler file

Submission date

Jun 04, 2021

Last update date

Oct 20, 2022

Contact name

Chikara Takeuchi

E-mail(s)

chikarabs52@keio.jp

Organization name

Keio University

Department

Molecular biology