GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM5359808

Query DataSets for GSM5359808

Status

Public on Oct 20, 2022

Title

Micro-C XL from EGFP-KD rep3

Sample type

SRA

Source name

EGFP-KD OSC

Organism

Drosophila melanogaster

Characteristics

cell type: Ovarian Somatic Cells (OSC)
treatment: RNAi EGFP
tissue: n/a
genotype: n/a

Growth protocol

Cells were grown at 26 degrees on OSC medium (Fly Extract added M3 medium).

Extracted molecule

genomic DNA

Extraction protocol

Micro-C XL: Micro-C XL is performed as previously described (Hsieh et al., 2020). 1.5x107 OSC were fixed with 1% Formaldehyde for 10min and quenched with final 0.75M Tris-HCl (pH 7.5) for 5min. After twice wash, OSC were fixed again with final 3mM DSG for 45min at room temperature and quenched with final 0.75M Tris-HCl(pH 7.5) for 5min. Nuclei were isolated with 100µl MBuffer#1 (50mM NaCl, 10mM Tris-HCl pH 7.5, 5mM MgCl2, 1mM CaCl2, 0.2% NP-40 and 1x Protease inhibitor(EDTA free)) and were incubated on ice for 20min. After washed with MBufer#1, nuclei were resuspended in MBuffer#1 again and 4,000gel units of MNase is added to solution, followed by incubation at 37°C for 10min with rotation. Reaction was stopped by adding 1µl of 0.5M EGTA (pH 8.0) and nuclei were washed twice with MBuffer#2(50mM NaCl, 10mM Tris-HCl pH 7.5, 10mM MgCl2). DNA ends are phosphorylated by 45µl end-chewing mix(5µl 10xNEBuffer 2.1, 10µl ATP(10mM), 2.5µl DTT(100mM), 2.5µl T4PNK(10U/µl), 25µl Milli-Q) and incubated at 37°C for 15min. After incubation, 5µl of Klenow fragment(5U/µl) was added and incubated at 37 °C for 15min again. DNA overhangs were filled with biotin by adding 25µl end-labeling mix(5µl biotin-14-dATP(1mM), 5µl biotin-14-dCTP(1mM),0.5µl d[G+T]TP(10mM), 2.5µl 10x T4 DNA Ligase Buffer, 0.25µl BSA(10mg/ml), 11.75µl Milli-Q), and incubated at 25°C for 45min. End labeling is stopped by adding 5µl 0.5M EDTA and inactivated by incubation at 65 °C for 20min. Collecting by centrifugation(12000g 5min), samples were washed with 1ml MBuffer#3(50mM Tris-HCl pH7.5, 10mM MgCl2). Chromatin pellet was resuspended in 250µl End-ligation mix(25µl 10xT4 DNA Ligase Buffer, 2.5µl BSA(10mg/ml), 12.5µl T4 DNA ligase(400U/µl), 210µl Milli-Q) and had rotated slowly at room temperature for 4hr. Collecting by centrifugation (16000g 5min), pellet was resuspended in Exonuclease solution (10µl 10xNEBuffer #1, 5µl Exonuclease III (100U/µl), 85µl Milli-Q) and sample was incubated at 37 °C for 15minto remove biotin from unligated ends. For deproteination and reverse crosslinking, 25 μl Proteinase K (20mg/ml) and 15µl RNase (0.5mg/ml) and 15µl 10% SDS were added and the sample was incubated at 65°C o/n. Ligated DNA was purified with isopropanol precipitation using Pellet Paint NF Co-precipitant (Merck) and resuspend in 150µl Milli-Q.
5μl Dynabeads MyOne Streptavidin C1 were washed twice with 300μl Tween wash buffer (5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M NaCl) and suspended in 150μl 2x Biotin binding buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 2 M NaCl). 150μl washed Streptavidin beads in 2x TBW were added to the sample and incubated rotation at RT for 20 min. Beads were washed twice with 300μl Tween wash buffer. These were used for library preparation with the GenTrack library preparation kit following the manufacturer’s protocol. To remove monomer or tetramer sized fragment, size-selection was performed with SPRI select after amplification of library.

Library strategy

OTHER

Library source

genomic

Library selection

other

Instrument model

HiSeq X Ten

Description

Sample 27
siE_library.dm6.mapq_30.200.mcool

Data processing

Library strategy: Micro-C XL
RNA-Seq: Reads of mRNA were mapped to dm6 by RSEM and STAR using following parameter (rsem-calculate-expression --paired-end -p 8 --star --star-path ~/anaconda3/bin --gzipped-read-file). DEG were detected by limma. For analysis of transposable elements, reads were mapped to dm6 using following parameter (--runMode genomeGenerate --genomeDir ${path_to_index} --genomeSAindexNbases 12 --genomeFastaFiles ${path_to_fasta}).
ChIP-Seq: Adaptors added by NEBNext Ultra II were cut by cutadapt using following parameters (cutadapt -j 12 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -A AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT -m 20 -o trim/${name2}_R1_trim.fastq.gz -p trim/${name2}_R2_trim.fastq.gz raw_file/${name2}_R1.fastq.gz raw_file/${name2}_R2.fastq.gz). For mapping to the genome, subsequent reads were mapped to the dm6 by bowtie2 using following parameters (bowtie2 -p 16 -x ${reference}/dm6 -N 1 -1 trim/${name2}_R1_trim.fastq.gz -2 trim/${name2}_R2_trim.fastq.gz -S sam_file/${name2}.sam). Peak call is performed by MACS using following parameter: for Mod(mdg4) isoforms(macs2 callpeak -t merge_file/Ty-AF_merge.sort.bam -c bam_file/Input-AF.sort.bam -n Ty-AF -f BAM -q 1e-15 -g dm --outdir peakcall_strict) and for PolII(macs2 callpeak -t ${item} -c ../bam_file/Input_All.sort.bam -n ${item%%.bam} -f BAM -g dm --outdir ../peakcall).
Micro-C XL: Distiller (https://github.com/open2c/distiller-nf) pipeline is used to process Micro-C datasets. First, sequencing reads were mapped to dm6 using bwa mem with flags-SP. Second, mapped reads were parsed and classified using the pairtools package (https://github.com/open2c/pairtools) to get cool file. PCR and/optical duplicates removed by matching the positions of aligned reads with 2bp flexibility. Next, pairs were filtered using mapping quality scores (MAPQ > 30) on each side of aligned chimeric read, binned into multiple resolutions and low coverage bins are removed. Finally multiresolution cooler files were created using the cooler package (https://github.com/open2c/cooler.git)(Abdennur and Mirny, 2019). We normalized contact matrices using the iterative correction procedure(Imakaev et al., 2012).
Genome_build: dm6
Supplementary_files_format_and_content: RNA-Seq: TPM and FPKM of each genes (flybase ID)
Supplementary_files_format_and_content: ChIP-Seq: bigwig file
Supplementary_files_format_and_content: Micro-C XL: multi-resolution cooler file

Submission date

Jun 04, 2021

Last update date

Oct 20, 2022

Contact name

Chikara Takeuchi

E-mail(s)

chikarabs52@keio.jp

Organization name

Keio University

Department

Molecular biology