|
| Status |
Public on Nov 28, 2021 |
| Title |
mock, rep 1 [A549_m_A] |
| Sample type |
SRA |
| |
|
| Source name |
A549-hACE2_mock
|
| Organisms |
Homo sapiens; Severe acute respiratory syndrome coronavirus 2 |
| Characteristics |
cell line: A549-hACE2
treatment/timepoint: mock
molecule subtype: small RNA
|
| Treatment protocol |
Cells were infected with SARS-CoV-2 at different MOIs and collected at different time points, some samples were subjected to either anti-Ago or anti-HA immunoprecipitation. The initial experiment was done in duplicate at high MOIs (series A and B). Subsequently we repeated the experiment for a third time and also adding a low MOI condition 24 hpi (series 1,2 and 3).
|
| Growth protocol |
Calu-3cells were cultured in EMEM with 10% FBS and Pen/Strep, PC-9 cells were cultured in RPMI medium with 10% FBS and Pen/Strep. A549-hACE2 were cultured in F-12 medium with 10% FBS, Pen/Strep and 1 μg/ml of puromycin. Calu-3-Ago2 and Calu-3-EV cells were cultured in the presence of 1 μg/ml of puromycin.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA was extracted using TRIzol according to manufacturer's protocol
1 mg of total RNA was used for library preparation using NEXTflex v2 kit (PerkinElemr) according to manufacture’s instructions
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
processed data file:
miRNA_counts.xlsx
FC.csv
|
| Data processing |
the reads were trimmed of adaptors using Cutadapt with the following settings -u 4 -O 7 -a N{4}TGGAATTCTCGGGTGCCAAGG -q 10 -m 18 -M
the reads were mapped with bowtie2 (--very-sensitive-local) to an index containing human and SARS-CoV-2 genomes
miRNAs were counted by using featureCounts and annotations obtained from miRbase (for Ago IP counts, viRNA-5p was added to the annotation file and treated as a host miRNA)
differential expression was determined using edgeR; because the series A,B and 1,2,3 were run separately, for differential expression analysis we used mock samples from series A, B, 1 and 2; all other conditions had three replicates.
track visualization was performed using an IGV browser of generated with BEDtools bed files
Genome_build: Homo_sapiens.GRCh38.100.chr,NC_045512.2
Supplementary_files_format_and_content: Matrix tables with raw gene counts for every miRNA and every sample (in different tabs)
Supplementary_files_format_and_content: Tables with differential expression (fold-change with P value)
Supplementary_files_format_and_content: Bed files for every sample at terminal time points
|
| |
|
| Submission date |
Sep 02, 2021 |
| Last update date |
Nov 28, 2021 |
| Contact name |
Paulina Pawlica |
| E-mail(s) |
paulina.pawlica@gmail.com
|
| Organization name |
Yale University
|
| Department |
MBB
|
| Lab |
Joan A. Steitz
|
| Street address |
295 Congress Avenue, BCMM Room 131
|
| City |
New Haven |
| State/province |
CT |
| ZIP/Postal code |
06511 |
| Country |
USA |
| |
|
| Platform ID |
GPL29105 |
| Series (1) |
| GSE183280 |
SARS-CoV-2 expresses a microRNA-like small RNA able to selectively repress host genes |
|
| Relations |
| BioSample |
SAMN21207403 |
| SRA |
SRX11996433 |
