|
| Status |
Public on Mar 10, 2022 |
| Title |
Blastocyst derived extracellular vesicles replicate 2 |
| Sample type |
SRA |
| |
|
| Source name |
Bovine embryos conditioned media
|
| Organism |
Bos taurus |
| Characteristics |
treatment: B
cell type: Blastocyst
media collection: 8 days post insemination
|
| Treatment protocol |
At 8 dpi, the developmental competence of each embryo was assessed, enabling a division of individually cultured embryos into two subgroups: 1) embryos that were not able to reach the blastocyst stage (non-blastocysts) and 2) blastocysts. CM of individually cultured blastocysts or non-blastocysts were pooled into two groups, both containing a total of nine replicates, used for extracellular vesicles isolation followed by total RNA isolation.
|
| Growth protocol |
Routine in vitro methods were used for bovine embryo production, as described previously by (Wydooghe, et al. 2014), during the embryo culture the persumed zygote were cultured individually in 20-µL droplets. covered with Paraffin oil (SAGE oil for tissue culture, ART-4008-5P, Cooper Surgical Company), at 38 °C in 5% CO2, 5% O2, and 90% N2.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Firstly, Evs were isolated by qEV single size exclusion column (IZON Science, Cat. Number: qEV single ser. Y1000588) from blastocyst and non-blastocyst groups. Further on, 600 µL (× 6 replicates (3 blastocyst and 3 non-blastocyst) of the concentrated EV pellet from each group was used for total RNA extraction, using the Plasma/Serum Circulating & Exosomal RNA Purification Mini Kit (Norgen Biotek, Cat. 51000) according to the manufacturer's protocol. The quality and concentration of the RNA samples were examined using an RNA 6000 Pico Chip (Agilent Technologies) and a Quant-iT RiboGreen RNA Assay kit (Life Technologies), respectively.
Small RNA library preparation was performed with the Tailormix v2 kit
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina MiSeq |
| |
|
| Data processing |
Quality and adapter trimming with cutadapt 2.0, cutadapt -j 20 --max-n 0 -a TGGAATTCTCGGGTGCCAAGG -m 15 -o <trimmed.fastq.gz> <in.fastq.gz>
Run mirPro, mirpro -i <trimmed.fastq.gz> -m <path_to_mirbase_v22.1/mature.fa> -p <path_to_mirbase_v22.1/hairpin.fa> -a null -s bta --novel 1 -g <Bos_taurus.ARS-UCD1.2.dna.toplevel.fa> --index <Bos_taurus.ARS-UCD1.2.dna.toplevel.idx> --other <other_species> <path_to_out/results> -t 20
Genome_build: Bos_taurus.ARS-UCD1.2 release 95 Ensembl
Supplementary_files_format_and_content: normalized_counts_deseq2.txt; first columns are the miRNA as obtained from mirPro, the remaining columns are normalized counts with DESeq2's default method
|
| |
|
| Submission date |
Mar 03, 2022 |
| Last update date |
May 03, 2023 |
| Contact name |
Krishna Chaitanya Pavani |
| E-mail(s) |
krishnachaitanya.pavani@ugent.be
|
| Phone |
092647797
|
| Organization name |
Ghent Univeristy
|
| Street address |
Salisburylaan 133, Merelbeke, Belgium
|
| City |
Merelbeke |
| State/province |
Gent |
| ZIP/Postal code |
9820 |
| Country |
Belgium |
| |
|
| Platform ID |
GPL19646 |
| Series (2) |
| GSE197875 |
Hatching is modulated by microRNA-378a-3p derived from extracellular vesicles secreted by blastocysts (miRNA) |
| GSE197878 |
Hatching is modulated by microRNA-378a-3p derived from extracellular vesicles secreted by blastocysts |
|
| Relations |
| BioSample |
SAMN26419619 |
| SRA |
SRX14360494 |
