GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM6185938

Query DataSets for GSM6185938

Status

Public on Jul 04, 2023

Title

Human_mouse_species_mixing

Sample type

SRA

Source name

GM12878/Mouse brain

Organisms

Homo sapiens; Mus musculus

Characteristics

tissue: GM12878/Mouse brain
age: N.A./10 weeks old
cell line: GM12878/Mouse brain
cell type: Human B-Lymphocyte/Mouse prefrontal cortex neurons and glia

Treatment protocol

N.A.

Growth protocol

GM12878 cells were purchased from Coriell Institute and propagated in RPMI 1640 (ATCC, 30-2001) containing 15% fetal bovine serum (Life Technologies Corporation, 16000044), 100 U/mL Penicillin-Streptomycin (contains 100 units/mL of penicillin and 100 µg/mL of streptomycin, Gibco from Thermo Fisher Scientific, 15140122) at 37 °C in a humidified incubator containing 5% CO2. GM12878 cells were sub-cultured every two days. HEK293 cells and MCF7 cells purchased from ATCC were cultured in DMEM (high glucose, Life Technologies Corporation, 11965084) containing 15% fetal bovine serum, 100 U/mL Penicillin-Streptomycin at 37 °C in a humidified incubator containing 5% CO2. HEK293 cells and MCF7 cells were sub-cultured when reaching ~80% confluency.

Extracted molecule

genomic DNA

Extraction protocol

10-week-old male mice were sacrificed by compressed CO2 followed by cervical dislocation. Mouse brains were rapidly dissected, frozen on dry ice and stored at -80°C. To collect prefrontal cortex (PFC) samples, mouse brains were sectioned coronally at Bregma 2.5 and 0.5 with a razor blade in dissection media (20 mM Sucrose, 28 mM D-Glucose, 0.42 mM NaHCO3 in HBSS). The dissected brain tissues were stored at -80 °C until use. Human brains were obtained during autopsies performed at the Basque Institute of Legal Medicine, Bilbao, Spain. The frozen PFC tissue belonged to a 41-year-old female with a PMI of 22 h. To isolate nuclei, the PFC was placed in 5 ml ice-cold nuclei extraction buffer (0.32 M sucrose, 5 mM CaCl2, 3 mM Mg(Ac)2, 0.1 mM EDTA, 10 mM Tris-HCl, and 0.1% Triton X-100 with freshly added 50 μl of PIC, 5 μl of 100 mM PMSF and 5 μl of 1M DTT). The tissue was thawed and homogenized by slowly douncing on ice with a loose pestle A (Kimble, 7-ml size) for 15 times, and with a pestle B for 25 times. We filtered the homogenate with a 40-μm nylon mesh cell strainer (Fisher Scientific, 22-363-547) and then centrifuged the sample at 1,000 g for 10 min at 4 °C. We then removed the supernatant and resuspended the pellet in 500 μl ice-cold nuclei extraction buffer. The suspension was mixed with 750 μl of 50% iodixanol solution (50% iodixanol, 25 mM KCl, 5 mM MgCl2, and 20 mM Tris-HCl (pH 7.8)) and centrifuged at 5,000 g for 15 min at 4 °C. After centrifugation, we followed the s3_WGS protocol1 to perform nuclei fixation and nucleosome depletion. Briefly, the nuclei pellet was resuspended in 5 ml of NIB:HEPES buffer (10 mM HEPES-KOH (pH 7.2), 10 mM NaCl, 3mM MgCl2, 0.1 % Igepal, 0.1 % Tween-20) in a 15 ml centrifuge tube (Corning, 430791). We incubated the mixture at room temperature for 10 min on a rotator (speed: 50 rpm, Argos Technologies RotoFlex) after adding 246 μl of 16 % formaldehyde (Thermo Fisher Scientific, 28908) to the suspension. The mixture was centrifuged at 500 g for 5 min at 4 °C to form nuclei pellet and the supernatant was then removed. 1 mL of NIB:Tris (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2, 0.1 % Igepal, 0.1 % Tween-20) was then added to resuspend and wash the nuclei pellet to quench the fixation. The nuclei were pelleted by centrifuging at 500 g for 5 min at 4 °C and resuspended in 200 μl 1X NEBuffer 2.1 (50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/ml BSA; NEB, B7202) in a 1.5 ml tube. The suspension was centrifuged at 500 g for 5 min at 4 °C to pellet nuclei which were then resuspended in 760 μl of 1X NEBuffer 2.1. We added 40 μl of 1 % SDS to the nuclei suspension and incubated the mixture at 37 °C for 20 min on a Multi-Therm shaker (Benchmark Scientific, H5000-HC) with a shaking speed of 300 rpm. After SDS treatment, the mixture was centrifuged at 500 g for 5 min at 4 °C. The pellet was resuspended in 1 ml of ATAC-RSB buffer (10 mM Tris-HCl (pH 7.4), 10 mM NaCl, 3 mM MgCl2 with freshly added 10 μl of 10% Tween-20). The suspension was pipetted up and down several times and then centrifuged at 500 g for 5 min at 4 °C. Finally, the nuclei were resuspended in 100 μl of ATAC-RSB buffer with freshly added 1 μl of 10% Tween-20. We measured the concentration of the nuclei using a hematocytometer and diluted the nuclei concentration to 5 million/ml using the ATAC-RSB buffer.
Library preparation follows Drop-BS protocol. We first completed single-cell lysis, genomic DNA fragmentation, DNA barcoding and bisulfite conversion in droplets. Then we used random priming to add the second adapter to DNA. Finally, we utilized indexing PCR to amplify DNA to obtain sequencing library.

Library strategy

Bisulfite-Seq

Library source

genomic

Library selection

RANDOM

Instrument model

HiSeq X Ten

Description

The species mixing data set is for quality control of the method. No processed data are available for this sample.

Data processing

Barcode extraction and raw read demultiplexing based on barcodes: Sequencing reads were demultiplexed based on i5/i7 indexes and split into different samples. Sequences ranging from the 25th base to the 39th base in Read 2 (from 5’ to 3’) were barcodes while the first 24 bases (TAAGTAGAAGATGGTATATGAGAT) were constant in Read 2. For each sample, a barcode whitelist was identified using umi_tools whitelist with the following settings: --stdin the read2 file, --error-correct-threshold=1, --extract-method=regex --bc-pattern='(?P<discard_1>TAAGTAGAAGATGGTATATGAGAT){s<=4}(?P<cell_1>.{15})(?P<umi_1>.{0})', --set-cell-number=5000, --log2stderr. Sequencing reads with a barcode within the barcode whitelist were extracted and had the barcode inserted in the header line, using umi_tools extract with the following settings: --stdin the R2 file, --extract-method=regex, --bc-pattern='(?P<discard_1>TAAGTAGAAGATGGTATATGAGAT){s<=4}(?P<cell_1>.{15})(?P<umi_1>.{0})', --error-correct-cell 1, --read2-in the R1 file, --filter-cell-barcode. Extracted sequencing R1 and R2 reads were trimmed by Tim Galore! with the following settings: --paired, --clip_R1 15, --clip_R2 40. Trimmed reads were demultiplexed into individual files based on the barcodes (i.e., reads with the same barcode were written into the same file) using idemp. Subsequently, alignment to the hg19/mm10 reference genome was performed with Bismark (bowtie2) using the default parameter settings for R2 reads and –pbat for R1 reads. Quality control and construction of allc file for each single cell We filtered out barcodes with lower mapping efficiency and lower number of raw reads based on the bismark report. Then we performed a sort on R1 and R2 reads using samtools sort before combining R1 and R2 together into one file for each single cell using bamtools merge. Subsequently, we used picard to get rid of duplicated reads in each singe cell. We used methyKit to call the methylation states for each cytosine in the unique reads. We finally constructed the allc file for each singe cell. The format of this allc file can be found here (https://github.com/yupenghe/methylpy). Construction of feature matrix and clustering We used the allc file to calculate the CG methylation rate for the three cell line data (or the CH methylation rate for the mouse/human brain data) over 1 Mbp (100 kbp for the mouse/human brain data) bins across the whole genome for each cell using a customized script (bin_allc_files.py). We combined the methylation rate data from each singe cell to a feature matrix. We then normalized the matrix by dividing by the global mCH in that cell. We carried out PCA to reduce the dimensions of the normalized matrix and used the top 50 principal components for Louvain clustering using a customized script. Finally, we projected the clustering results using UMAP.
Assembly: hg19, mm10
Supplementary files format and content: tab delimited text files of methylcytosine calls; columns in allc files are: column 1 - chromosome; column 2 - position; column 3 - strand; column 4 - class; column 5 - mC reads; column 6 - total reads; column 7 - methylated (Boolean value indicating the result of statistical test for methylated cytosines)

Submission date

May 24, 2022

Last update date

Jul 04, 2023

Contact name

Chang Lu

E-mail(s)

changlu@vt.edu

Phone

5402318681

Organization name

Virginia Tech