 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Nov 04, 2022 |
| Title |
ID216_DNaseI |
| Sample type |
SRA |
| |
|
| Source name |
CD34+ AML cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell type: CD34+ AML cells
genotype: CEBPA double mutant
disease: Acute Myeloid Leukemia
|
| Growth protocol |
Patient cells were cultured at the concentration of 1x106 cell/mL in StemSpanTM Serum-Free Expansion Medium II (SFEM II) (STEMCELL Technologies) supplemented with 10% StemSpanTM CD34+ Expansion Supplement and 175nM UM171 (STEMCELL Technologies). Other patient cells were grown in SFEM II supplemented with 100 ng/mL thrombopoietin, 10 ng/mL FMS-like tyrosine kinase 3 ligand, 750 nM Stem Regenin 1 (SRI), 10 ng/mL Interleukin 3, 10 ng/mL human granulocyte/macrophage colony stimulating factor, 150 ng/mL Stem Cell Factor (SCF) (all Peprotech) and UM729 (STEMCELL Technologies). Patient CD34+ or CD117+ hematopoietic progenitors were isolated with CD34 MicroBead Kit, human or CD117 MicroBead Kit, human (Miltenyi-Biotech) as described in PMID:30420649
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNase I digestions of permeabilized cells were performed briefly as follows: live cells were added directly to a solution of DNase I (DPFF, Worthington) in dilute Nonidet P40, digested for 3 min at 22oC, and the reactions then terminated by addition of SDS to 0.5%. DNase I was typically used in the range of 2-6 μg/ml using a final 1.5 x 107 cells/ml. DNase I (DPFF) was obtained from Worthington Biochemical Corporation and typically used in the range of 2-6 μg/ml using a final 1.5 x 107 cells/ml. The DNA digestion extent was comparable in all the generated samples as measured by RT-PCR. DNase-Seq libraries were then prepared. Levels of DNase I digestion were assessed using quantitative real-time PCR, measuring the ratio of the presence of known DNase I hypersensitive regions compared to a more resistant inactive region. Sequences of the PCR primers used for this purpose were, for the active region, TBP promoter 5´- CTGGCGGAAGTGACATTATCAA and 5´- GCCAGCGGAAGCGAAGTTA; and for the inactive region, a region of chromosome 18: 5´- ACTCCCCTTTCATGCTTCTG and 5´- AGGTCCCAGGACATATCCATT.
DNase-Seq samples were generated from a size selection of DNase I-digested DNA fragments comprised within a range of 100 to 250 bp (not including linkers) and subjected to library preparation as per manufacturer´s instruction (Illumina).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Sequencing adapters and low-quality reads and were removed using Trimmomatic
Reads were then mapped to the human genome version hg38 using Bowtie v2.2.3
PCR duplicated reads were removed using the MarkDuplicates funtion Picard tools
Open chromatin regions (peaks) were identified using MACS2 and bedGraph files were generated by including the options -B --trackline
Assembly: hg38
Supplementary files format and content: bedGraph files of read pileups generated by MACS2
Library strategy: Dnase-Hypersensitivity
|
| |
|
| Submission date |
Aug 11, 2022 |
| Last update date |
Nov 04, 2022 |
| Contact name |
Peter Keane |
| E-mail(s) |
p.keane@bham.ac.uk
|
| Organization name |
University of Birmingham
|
| Department |
Institute for Cancer and Genomic Sciences
|
| Street address |
Vincent Drive
|
| City |
Birmingham |
| ZIP/Postal code |
B15 2TT |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL18573 |
| Series (2) |
| GSE211089 |
Identification and interrogation of the gene regulatory network of CEBPA double mutant Acute Myeloid Leukaemia [Patient DNase1-seq] |
| GSE211095 |
Identification and interrogation of the gene regulatory network of CEBPA double mutant Acute Myeloid Leukaemia |
|
| Relations |
| BioSample |
SAMN30273910 |
| SRA |
SRX17036246 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM6449903_ID216_DNaseI_treat_pileup.bedGraph.gz |
52.1 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
