|
| Status |
Public on Jun 23, 2023 |
| Title |
input_wildtype_opaque_bio_rep_2 |
| Sample type |
SRA |
| |
|
| Source name |
input small RNA, wildtype opaque cells
|
| Organism |
Candida albicans |
| Characteristics |
cell line: AHY135
cell type: planktonic cells
genotype: wildtype
treatment: no treatment
|
| Treatment protocol |
no treatment
|
| Growth protocol |
Candida albicans cultures were grown overnight in 5 mL synthetic dextrose (+complete amino acid mix) (SDAA) liquid media inside a shaking incubator (25 deg C, 210 RPM shaking). Overnight cultures were subsequently backdiluted to 0.1 optical density in 50 mL SDAA liquid media and incubated inside a shaking incubator (25 deg C, 210 RPM shaking). When O.D of cultures reached 0.6 - 0.8 O.D, cells were imediately pelleted using a centrifuge and liquid supernatant removed.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
RNA from cell pellets were extracted using mirVana miRNA isolation kit from thermofisher per manufactureres instructions.
Sequencing ready libraries were prepared using using NEB’s small RNA library preparation kit.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina HiSeq 4000 |
| |
|
| Data processing |
sequence reads were trimmed for adaptor sequences using homerTools trim function with the following parameters: "-3 AGATCGGAAGAGCACACGTCT -mis 2 -minMatchLength 4 -min 20"
trimmed reads were aligned to Candida albicans genome assembly 21 using the Star aligner with the following parameters: STAR --genomeDir GenomeIndexForhg38/ --runThreadN 24 --readFilesIn exp1.csRNA.fastq.gz.trimmed --outFileNamePrefix exp1.csRNA.fastq.gz.trimmed. --outSAMstrandField intronMotif --outMultimapperOrder Random --outSAMmultNmax 1 --outFilterMultimapNmax 10000 --limitOutSAMoneReadBytes 10000000
tag directories were created using HOMER's "makeTagDirectory " function. These tag directories were subsequently used as input to create bigwig files using HOMER's "makeUCSCfile" function (default parameters).
Assembly: Candida albicans Assembly21
Supplementary files format and content: bigwig visualization files
|
| |
|
| Submission date |
Nov 06, 2022 |
| Last update date |
Jun 23, 2023 |
| Contact name |
Ruihao Li |
| E-mail(s) |
rli46@ucmerced.edu
|
| Organization name |
University of California, Merced
|
| Department |
QSB/MCB
|
| Lab |
Aaron Hernday lab
|
| Street address |
5200 NORTH LAKE ROAD
|
| City |
MERCED |
| State/province |
CA |
| ZIP/Postal code |
95340 |
| Country |
USA |
| |
|
| Platform ID |
GPL24129 |
| Series (1) |
| GSE217383 |
Inferring gene regulatory networks via transcriptional profiles as associated dynamical attractors |
|
| Relations |
| BioSample |
SAMN31622035 |
| SRA |
SRX18180173 |
