 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 09, 2024 |
| Title |
UT_tgirt70 |
| Sample type |
SRA |
| |
|
| Source name |
bacterial cells
|
| Organism |
Escherichia coli |
| Characteristics |
strain: MG1655
cell type: bacterial cells
treatment: UT
group: UT_tgirt70
|
| Treatment protocol |
Cells were exposed to modifying reagent for 5 min, quenched with 5 molar excess DTT for 2 min.
|
| Growth protocol |
E. coli cells were grown by shaking in LB to mid exponential phase at 37°C
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cell growth was arrested by transferring all 6 mL of treated cell cultures to 6 mL of a frozen slurry containing 10 mM Tris-HCl (pH 7.2), 5 mM MgCl2, 25 mM NaN3, 1.5 mM chloramphenicol, and 12.5% ethanol, followed by incubation for 5 min on ice. Cells were harvested by centrifugation for 20 min. For ETC- treated cells that resisted standard lysis protocols, cell pellets were resuspended in 100 μL of 10 mg/mL lysozyme and incubated for 10 min at room temperature with brief vortexing every 2 min. The cell mixture was transferred to a 2 mL screw cap tube along with 700 μL of RLT buffer from the RNeasy Mini kit (Qiagen) and 700 μL of 150-212 μm acid washed glass beads (Sigma). Cells were lysed with a bead-beater at max speed for 2.5 min three times; cells were incubated for 5 min on ice between rounds. For untreated, EDC, and DMS treated cells, cell pellets were resuspended in 100 μL of 3 mg/mL lysozyme and incubated for 20 min at 37°C for cell lysis. The rest of the extraction followed the RNeasy Mini Kit instructions. Purified RNA samples were treated with RQ1 DNase (Promega), and then the DNase was inactivated with the provided stop solution by incubating for 5 min at 65°C . RNA was then ethanol precipitated by adding 10 μL 5M NaCl, 1 μL GlycoBlue™ (Thermofisher), and 250 μL of 100% ethanol for every 100 μL of sample. If the sample volume surpassed 100 μL, 1 μL of GlycoBlue™ was added and the remaining volume was supplemented with colorless, Invitrogen UltraPure glycogen (Fisher Scientific).
Sequencing libraries for Illumina paired-end 150x150 Next-Seq 2000 were prepared by adapting the xGen Broad-Range RNA Library Preparation Kit (IDT) protocol. 150 ng of total RNA was brought to 7 μL in water and mixed with 1 μL of RNA Reagent F1, 4 μL of RNA Buffer F3, and 2 μL of RNA Buffer F4. This mixture was heated for 3 min to 94°C to fragment the RNA and then it was immediately chilled for 2 min on ice. Library preparation varied only at the RT reaction and libraries were prepared as follows. For libraries with TGIRT-III, a mixture of 2 μL of TGIRT-III enzyme (Ingex), 1 μL of R1 (RNase inhibitor), and 2 μL of 50 mM DTT was added to the fragmented RNA and incubated for 10 min at room temperature before 2 μL of RNA Reagent F2 (dNTPs) was added. The RT reaction was carried out at for 20 min 20°C, for 30 min 42°C, and for 45 min at 50°C, 55°C, 60°C, or 65°C. For libraries with Marathon RT, a mixture of 1 μL Marathon RT enzyme (Kerafast), 1 μL of R1, 0.5 μL of 200 mM DTT, 0.5 μL of 80 mM MnCl2, and 4 μL of 100% glycerol was added to the fragmented RNA and incubated for 10 min at room temperature before 2 μL of RNA reagent F2 was added. The RT reaction was carried out for 3 h at 42°C. For libraries with SuperScript-II, a mixture of 2 μL SuperScript-II enzyme (ThermoFisher), 1 μL of R1, 1 μL of 200 mM DTT, and 1 μL of 60 mM MnCl2 was added to the fragmented RNA and incubated for 10 min at room temperature before 2 μL of RNA reagent F2 was added. The RT reaction was carried out for 3 h at 42°C. For libraries with HIV-RT, a mixture of 2 μL HIV RT enzyme (Worthington Biochemical Corporation), 1 μL of R1, and 2 μL of 100 mM DTT was added to the fragmented RNA and incubated for 10 min at room temperature before 2 μL of RNA reagent F2 was added. The RT reaction was carried out for 1 h at 37°C. Following RT, RNA was degraded with 1 μL of 4M NaOH and incubated for 3 min at 95°C and then cooled to 4°C. An equal amount of HCl was added to neutralize the mixture and then 26 μL of low EDTA TE buffer provided by the library kit was added to bring the sample to 50 μL. A size-selection clean-up with AMPure XP beads (Beckman Coulter) was done with 90 μL of beads and eluted in 12 μL of low EDTA TE buffer. Ten μL of the eluate was transferred to a fresh tube before continuing with the Adaptase, Extension, Ligation, and Indexing PCR as instructed in the kit. Rather than a final AMPure XP bead clean-up, amplified cDNA was purified by an 8% non-denaturing polyacrylamide gel extraction (150-600 bps) and ethanol precipitation.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
NextSeq 2000 |
| |
|
| Data processing |
trimming: Paired end sequencing reads were first trimmed with cutadapt to remove sequencing primers and the 10 nt random sequence from the adaptase step (cutadapt -a NNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCA -A AGATCGGAAGAGCGTCGTGTAGGGAAAGA -g AGATCGGAAGAGCGTCGTGTAGGGAAAGA -G TGACTGGAGTTCAGACGTGTGCTCTTCCGATCTNNNNNNNNNN -q 30,30 -m 20)
mapping/ identification of mutation rates: For analysis without filtering mutations, trimmed reads were then processed using ShapeMapper2 with bowtie2 alignment and a random primer length of 10 nt. The mutation types were quantified using the output from --output-counted-mutations. To apply mutation filtering, the --dms flag was used.
normalization: Background-subtracted mutation rates from ShapeMapper2 were 2-8% normalized with all four residues together within a transcript for final reactivity calculations. As in ShapeMapper2, any residue with untreated modification rate over 0.05% was removed from analysis.
Assembly: genomebuild_assembly.txt
Supplementary files format and content: All profile.txt files are formatted as a csv that includes the RNA transcript (RNA), nucleotide number (Nucleotide), nucleotide sequence (Sequence), number of mutations in the modified sample (Modified_mutations), read depth in the modified sample (Modified_read_depth), effective read depth in the modified sample (Modified_effective_depth), mutation rate of modified sample (Modified_rate), depth of off target reads in modified sample (Modified_off_target_mapped_depth), depth of low quality reads in the modified sample(Modified_low_mapq_mapped_depth), the total depth of the modified sample(Modified_mapped depth), number of mutations in the untreated sample (Untreated_mutations), read depth in the untreated sample (Untreated_read_depth), effective read depth in the untreated sample (Untreated_effective_depth), mutation rate of untreated sample (Untreated_rate), depth of off target reads in untreated sample (Untreated_off_target_mapped_depth), depth of low quality reads in the untreated sample(Untreated_low_mapq_mapped_depth), the total depth of the untreated sample(Untreated_mapped depth), background subtracted mutation rates (raw_reactivity), and normalized reactivity values (norm_reactivity).
Supplementary files format and content: File names that contain "merge" are counts from the three pooled bioreplicates. Files names that contain "filt" applied mutation signature filtering.
Library strategy: DMS/ETC MaP-seq
|
| |
|
| Submission date |
Feb 02, 2024 |
| Last update date |
Apr 09, 2024 |
| Contact name |
Catherine A Douds |
| E-mail(s) |
cad87@psu.edu
|
| Organization name |
Penn State University
|
| Department |
BMMB
|
| Lab |
Philip C. Bevilacqua
|
| Street address |
8148633109
|
| City |
State College |
| State/province |
Pennsylvania |
| ZIP/Postal code |
16802 |
| Country |
USA |
| |
|
| Platform ID |
GPL32081 |
| Series (1) |
| GSE254895 |
A new reagent for in vivo structure probing of RNA G and U residues that improves RNA structure prediction alone and combined with DMS |
|
| Relations |
| BioSample |
SAMN39746376 |
| SRA |
SRX23506765 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM8059894_UT_tgirt70_profile.txt.gz |
202.3 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
|
|
|
|
 |
