GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM8307234

Query DataSets for GSM8307234

Status

Public on Jun 05, 2024

Title

non-transduced, DMSO vehicle control, t=3 hours post-onset of stimulation, sample 1

Sample type

SRA

Source name

femoral cartilage

Organism

Sus scrofa

Characteristics

tissue: femoral cartilage
cell type: primary chondrocyte
genotype: WT/NT
treatment: Vehicle Control
time point: 3 hours

Treatment protocol

To study TRPV4 activation and IL-1 inflammatory signalling, constructs were stimulated for 3 hours with cyclic, unconfined compressive loading (10% peak-to-peak deformation, 1 Hz) with or without TRPV4 antagonist GSK205 (10 mM) or treated with TRPV4 agonist GSK101 (1 nM) or 1 ng/mL of IL-1a. Vehicle controls were exposed to DMSO (1:1000 in media) but left free swelling. For both TRPV4 and IL-1 stimulation groups, tissue constructs were taken down at 3 hours and 9 hours post stimulation onset, flash frozen, and stored at -80C (n=4 per group).
To study PIEZO1 activation, PIEZO1 needed to be inhibited by siRNA transfection ,as no small molecule inhibitors of PIEZO1 are currently known. Cells were transfected (DharmaFECT Transfection Reagent, Dharmacon) with siRNA targeting PIEZO1 (siPIEZO1) [1], a non-targeting control siRNA (siNTC), or left non-transfected (NT). PIEZO1-targeting siRNA sequences included CAGCGAGAUCUCGCACUCCAUC (siPIEZO1a), UACGACCUGCUGCAGCUCCUG (siPIEZO1b), and ACCCGCUGGCCAUGCAGUUCUU (siPIEZO1c) to target different transcript variants of PIEZO1 (custom siRNA, Dharmacon). These siRNAs were added to DMEM-HG for a final concentration of ~222 nM siPIEZO1a, ~278 nM siPEIZO1b, and ~278nM siPIEZO1c. Separately, DharmaFECT reagent was diluted 3:50 in DMEM-HG. Each solution was incubated at room temperature for 5 min. The two solutions were then mixed 1:1, and incubated at room temperature for 20 min. Lastly, 500mL of the siRNA/DharmaFECT solution was added to each well.
After siRNA transfection, constructs were subjected to a single round of quasi-static unconfined compression to 80% deformation (supraphysiologic range) at 1.9% deformation/min (~0.73 mm/sec), treated with PIEZO1 agonist Yoda1 (5 mM), or standard media with a DMSO vehicle control (1:1000) but left free swelling. This timepoint was chosen as it displayed the peak PIEZO1 knockdown in the siPIEZO1 group, similar to previous studies [1]. In response to stimulation, tissue constructs were taken down at 3 hours and 9 hours post stimulation onset, flash frozen, and stored at -80C (n=4 per group).

Growth protocol

primary chondrocytes were cast in 2% agarose to form tissue engineered cartilage constructs. These constructs were cultured at 37°C and 5% CO2 in media consisting of DMEM-HG, 10% Fetal Bovine Serum (FBS), 7.5% HEPES Buffer, 5% MEM Non-Essential Amino Acids (MEM NEAA), and 5% Penicillin/Streptomycin (P/S)

Extracted molecule

polyA RNA

Extraction protocol

RNA was isolated (~0.5ug from TRPV4 and IL-1 groups, ~100ng from PIEZO1 groups) from all tissues using a bead shaker and the Norgen Biotek RNA/protein purification plus kit (Norgen Total RNA kits).
For all TRPV4 and IL-1 groups: Library preparation was performed with 1 to 3ug of total RNA. Ribosomal RNA was removed by a hybridization method using Ribo-ZERO kits (Illumina-EpiCentre). mRNA was then fragmented in reverse transcriptase buffer and heating to 94 degrees for 8 minutes. mRNA was reverse transcribed to yield cDNA using SuperScript III RT enzyme (Life Technologies, per manufacturer's instructions) and random hexamers. A second strand reaction was performed to yield ds-cDNA. cDNA was blunt ended, had an A base added to the 3' ends, and then had Illumina sequencing adapters ligated to the ends. Ligated fragments were then amplified for 12-15 cycles using primers incorporating unique dual index tags. Fragments were sequenced on an Illumina NovaSeq-6000 using paired end reads extending 150 bases.
For all PIEZO1 groups: Library preparation was performed with 10ng of total RNA with a Bioanalyzer RIN score greater than 8.0. ds-cDNA was prepared using the SMARTer Ultra Low RNA kit for Illumina Sequencing (Takara-Clontech) per manufacturer's protocol. cDNA was fragmented using a Covaris E220 sonicator using peak incident power 18, duty factor 20%, cycles per burst 50 for 120 seconds. cDNA was blunt ended, had an A base added to the 3' ends, and then had Illumina sequencing adapters ligated to the ends. Ligated fragments were then amplified for 12-15 cycles using primers incorporating unique dual index tags. Fragments were sequenced on an Illumina NovaSeq-6000 using paired end reads extending 150 bases.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NovaSeq 6000

Data processing

Raw files were processed with Trim Galore! (Babraham Bioinformatics) to decrease noise and remove excess/low quality reads. Post-processing, these reads were aligned to the porcine reference genome (assembly: GCA_000003025.6 Sscrofa11.1.99) by STAR. Reads aligned with each annotated gene or transcript were counted using HTseq.
Assembly: GCA_000003025.6 Sscrofa11.1.99
Supplementary files format and content: .csv file contains raw gene counts for each sample

Submission date

Jun 05, 2024

Last update date

Jun 05, 2024

Contact name

Farshid Guilak

E-mail(s)

guilak@wustl.edu

Organization name

Washington University in St. Louis

Department

Dept of Orthopedics