GEO Profile Links for Gene (Select 66972) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1306

<< First< Prev

Page of 66

Next >Last >>

Select item 1028884671.

Slc25a23 - Cardiomyocyte-specific Gata-4 or Gata-6 knockout effect on adult heart during pressure overload

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL6246, 10452257 (ID_REF), GDS4782, NM_025877, BC072660, chr17:57043711-57059863 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 102888467

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 231933502.

Slc25a23 - Primary visual cortex response to visual input deprivation (MG-U74B)

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL82, 106250_at (ID_REF), GDS1984, 66972 (Gene ID), AI851655

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 23193350

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74670003.

Slc25a23 - MPSS transcriptome analysis project

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGGTCCCTCTGGGA (ID_REF), GDS868, NM_025877

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7467000

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10647244.

Slc25a23 - Platform type/amplification method cross comparison (16K cDNA)(II)

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL260, 15016 (ID_REF), GDS225, AK010088

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1064724

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968306675.

Slc25a23 - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL6246, 10452257 (ID_REF), GDS4486, NM_025877, BC072660, chr17:57043711-57059863 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96830667

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 431818766.

Slc25a23 - Cerebral cortex and hypothalamus response to sleep and sleep deprivation: time course

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS2882, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 90 samples

ID:: 43181876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969680677.

Slc25a23 - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL6246, 10452257 (ID_REF), GDS4490, NM_025877, BC072660, chr17:57043711-57059863 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96968067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 673766768.

Slc25a23 - Zinc finger transcription factor PLAGL2 effect on primary p53-null neural stem cells

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS3767, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 67376676

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 512129769.

Slc25a23 - Transcriptional coactivator PGC-1beta hypomorphic mutation effect on the liver

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS3197, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 51212976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1840987710.

Slc25a23 - Aldosterone effect on kidney cortical collecting cell line: time course

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL2623, M200004677 (ID_REF), GDS1707, NM_025877

DataSet type:: Expression profiling by array, log2 ratio, 8 samples

ID:: 18409877

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 760470011.

Slc25a23 - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCAGGTCCCTCTGGGA (ID_REF), GDS878, NM_025877

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7604700

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 106589612.

Slc25a23 - Platform type/amplification method cross comparison (16K cDNA)(II)

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL260, 16379 (ID_REF), GDS225, AK007476

DataSet type:: Expression profiling by array, log ratio, 6 samples

ID:: 1065896

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11229577613.

Slc25a23 - Cystatin B knockout model of progressive myoclonus epilepsy: cultured cerebellar granule cells

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS5091, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 112295776

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9742906714.

Slc25a23 - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL6246, 10452257 (ID_REF), GDS4517, NM_025877, BC072660, chr17:57043711-57059863 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97429067

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 5526525015.

Slc25a23 - Visual cortex during the critical period for ocular dominance (MG-U74B)

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL82, 106250_at (ID_REF), GDS3376, 66972 (Gene ID), AI851655

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 55265250

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4543607616.

Slc25a23 - Vitamin E supplementation effect on aged brain

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS2973, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 45436076

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4396997617.

Slc25a23 - Various brain regions of several inbred strains

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS2917, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43969976

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 3930987618.

Slc25a23 - Ketogenic diet effect on the liver

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL1261, 1419045_at (ID_REF), GDS2738, 66972 (Gene ID), NM_025877

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 39309876

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11253498919.

Slc25a23 - Irradiation effect on peripheral blood mononuclear cells: dose response

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL4783, M300017246 (ID_REF), GDS2645, NM_025877, AK010088

DataSet type:: Expression profiling by array, log2 ratio, 28 samples

ID:: 112534989

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11249574820.

Slc25a23 - Wnt4 mutation effect on female embryonic gonads

Annotation:: Slc25a23, solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23

Organism:: Mus musculus

Reporter:: GPL3108, 5648 (ID_REF), GDS2574, NM_025877

DataSet type:: Expression profiling by array, log2 ratio, 4 samples

ID:: 112495748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 66

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 66972) (1306)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1306

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity