GEO Profiles Links for Nucleotide (Select 28386252) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 145

<< First< Prev

Page of 8

Next >Last >>

Select item 75029311.

Obscn - MPSS transcriptome analysis project

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL1010, GATCGTTCCCTACCAACCTG (ID_REF), GDS868, BC046431

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7502931

GEO DataSets Gene Chromosome neighbors Homologene neighbors

Select item 1320144142.

Obscn - Nebulin deficiency effect on the quadriceps

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5880, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132014414

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 927576143.

Obscn - Neurofibromin inactivation effect on triceps muscle

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4447, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 92757614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1320511144.

Obscn - Nebulin deficiency effect on the soleus

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5881, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132051114

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1140359145.

Obscn - Synergist ablation effect on young adult plantaris muscle: time course

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4932, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 114035914

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1067965146.

Obscn - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4899, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106796514

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1065860147.

Obscn - Heart response to isocitrate dehydrogenase 2 mutations IDH2R140Q and IDH2R172K

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4893, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 106586014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 896103148.

Obscn - Lung epithelium response to fungal allergen Alternaria

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4423, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89610314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1028813149.

Obscn - Cardiomyocyte-specific Gata-4 or Gata-6 knockout effect on adult heart during pressure overload

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4782, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 102881314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8486461410.

Obscn - Ts65Dn aneuploidy model of Down syndrome: skeletal muscle

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4376, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 84864614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10642341411.

Obscn - Histone deacetylase 3 deficiency effect on the heart

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4886, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 106423414

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8989931412.

Obscn - Sex effect on chronic coxsackievirus B3-induced myocarditis: heart

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4436, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 89899314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10717461413.

Obscn - Cyclophilin D deficiency effect on the heart

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4913, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 107174614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11892901414.

Obscn - Ankle joint response to the induction of arthritis

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5244, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118929014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10903701415.

Obscn - Phorbol ester effect on skin of Rho exchange factor Vav2/Vav3 double knockout mutants: time course

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4985, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 109037014

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11858261416.

Obscn - Sarcolipin deficiency effect on heart atrium

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5236, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118582614

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10261771417.

Obscn - Peroxisome Proliferator-Activated Receptor γ Coactivator-1 deficiency effect on adult cardiac biventricle

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4776, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 102617714

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8748731418.

Obscn - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS4317, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87487314

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11084351419.

Obscn - Pristane-induced arthritis effect on AIRmax and AIRmin acute inflammation model: footpad

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5052, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110843514

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11080681420.

Obscn - Pristane-induced arthritis effect on AIRmin low acute inflammation model: footpad

Annotation:: Obscn, obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF

Organism:: Mus musculus

Reporter:: GPL6246, 10386238 (ID_REF), GDS5051, NM_001171512, AY603754, BC046431, chr11:58994332-59008610 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 110806814

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 28386252) (145)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 145

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity