GEO Profiles Links for Nucleotide (Select 902763259) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 298

<< First< Prev

Page of 15

Next >Last >>

Select item 1316376741.

Tmcc2 - Normal liver developmental stages: embryonic and postnatal

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P454993 (ID_REF), GDS5818, NM_178874, A_51_P454993 (SPOT ID)

DataSet type:: Expression profiling by array, log2 ratio, 11 samples

ID:: 131637674

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1194003742.

Tmcc2 - Chronic, low level drug exposure effect on obese liver

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL7202, A_51_P454993 (ID_REF), GDS5258, NM_178874, A_51_P454993 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 119400374

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 990307013.

Tmcc2 - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6246, 10357698 (ID_REF), GDS4556, NM_178874, XM_006529852, XM_006529853, XM_006529854, AK157378, BC052035, chr1:132356315-132391281 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99030701

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74755214.

Tmcc2 - MPSS transcriptome analysis project

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCACGTTGAGTTCTATTT (ID_REF), GDS868, NM_178874

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7475521

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1276011855.

Tmcc2 - Progranulin deficiency effect on various brain regions: time course

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2593104 (ID_REF), GDS5501, NM_178874

DataSet type:: Expression profiling by array, transformed count, 99 samples

ID:: 127601185

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 824787116.

Tmcc2 - ROR alpha1 deletion effect on skeletal muscle

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6105, ILMN_2593104 (ID_REF), GDS3720, NM_178874

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 82478711

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 468308277.

Tmcc2 - Dicer inactivation effect on the embryonic heart

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL5025, 33327 (ID_REF), GDS3033, NM_178874

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 46830827

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1017434018.

Tmcc2 - Hematopoietic cell response to Xist deficiency in females: time course

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6246, 10357698 (ID_REF), GDS4755, NM_178874, XM_006529852, XM_006529853, XM_006529854, AK157378, BC052035, chr1:132356315-132391281 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 20 samples

ID:: 101743401

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 625517799.

Tmcc2 - Huntington disease model: brain striatum (Ref-6 V1)

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6333, scl068875.1_8-S (ID_REF), GDS3621, NM_178874, 1110063G11Rik (ORF)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 62551779

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11813098510.

Tmcc2 - Spleen response to infection by Plasmodium yoelii strains N67 and N67C

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2593104 (ID_REF), GDS5225, NM_178874

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118130985

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11814710111.

Tmcc2 - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6246, 10357698 (ID_REF), GDS5226, NM_178874, XM_006529852, XM_006529853, XM_006529854, AK157378, BC052035, chr1:132356315-132391281 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118147101

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4820985512.

Tmcc2 - Iron overload effect on cardiac and skeletal muscles

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL4234, 6420019 (ID_REF), GDS3086, NM_178874

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 48209855

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9713374813.

Tmcc2 - SmoA1 and SmoA2 models of medulloblastoma: postnatal day 5 brain

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL9734, 100112624_TGI_at (ID_REF), GDS4495, NM_178874

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 97133748

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11593394214.

Tmcc2 - Auditory fear conditioning effect on amygdala: time course

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6887, ILMN_2593104 (ID_REF), GDS5157, NM_178874, TMCC2 (ORF)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 115933942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7567263315.

Tmcc2 - High, Normal, and Low Anxiety: multiple brain regions

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6481, 6900762 (ID_REF), GDS4002, NM_178874, 1110063G11Rik (CLONE ID)

DataSet type:: Expression profiling by array, count, 75 samples

ID:: 75672633

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10830368516.

Tmcc2 - Claudin 18 deficiency effect on the lung

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2593104 (ID_REF), GDS4961, NM_178874

DataSet type:: Expression profiling by array, transformed count, 7 samples

ID:: 108303685

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12130258517.

Tmcc2 - Restless Legs Syndrome model: adult whole brain

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2593104 (ID_REF), GDS5299, NM_178874

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 121302585

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6668424318.

Tmcc2 - Intratracheal lipopolysaccharide (IT LPS)-induced lung injury effect on Rag-1 null, lymphocyte-deficient mutants

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL4865, scl068875.1_8-S (ID_REF), GDS3749, NM_178874

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 66684243

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9232440119.

Tmcc2 - MyD88 and TRIF deficient spleen response to septic peritonitis

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6246, 10357698 (ID_REF), GDS4433, NM_178874, XM_006529852, XM_006529853, XM_006529854, AK157378, BC052035, chr1:132356315-132391281 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 92324401

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12633028520.

Tmcc2 - Lung from cigarette smoke-related chronic obstructive pulmonary disease model: time course

Annotation:: Tmcc2, transmembrane and coiled-coil domains 2

Organism:: Mus musculus

Reporter:: GPL6885, ILMN_2593104 (ID_REF), GDS5438, NM_178874

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 126330285

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 15

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 902763259) (298)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 298

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity