high/low antibody responder to rubella vaccination: Low Sex: Male age: 12 time from last vaccination to enrollment (years): 8.1 id50: 22.5666666666667
Extracted molecule
protein
Extraction protocol
Serum samples were diluted 1:100 in Protein Array Blocking Buffer (Whatman, Inc.; Sanford, ME) supplemented with 10% DH5-α Escherichia coli lysate (Antigen Discovery, Inc.), incubated for 30 minutes, and probed on arrays overnight at 4°C. Chips were developed by PCR amplification of cDNA for all rubella virus proteins, as previously described (Davies DH et al., 2005; Luevano M et al., 2010; Kalantari-Dehaghi M et al., 2012). The amplicons were inserted into pXi T7-based exvectors, expressed in coupled in-vitro transcription-translation (IVTT) reactions, and printed onto the microarray slides. cDNAs were created by RT-PCR from Rubella virus/RV (strain RA27/3, Taxonomy ID) infected cells (total RNAs were extracted using the Qiagen RNeasy Plus mini kit and PCR was performed using the Novagen’s KOD Hot Start DN Polymerase kit/Cat # 71086). The following RV-specific primers were used: for envelope glycoprotein 1/E1 RubE1-F gaggaggctttcacctacctctgca and RubE1-R gcgcggcgctatagcgc; for envelope glycoprotein 2/E2 RubE2-F gggctccagccccgcgct and RubE2-R gccataggcgggggggttgt ; for capsid protein/CP RubC-F atggcttctactacccccatcaccatgga and RubC-R ggcgcgcgcggtgcc ; for nonstructural protein P150 Rub150-F atggagagactcctagatgaggttc and Rub150-R gacagggggaccgcg ; for nonstructural protein P90 RubP90-F cggggcggtggcacc and RubP90-R tagtcagcgtcgtggagattggc. PCR amplicons were verified by sequencing. The amplicons were inserted into pXi T7-based exvectors, and the products were expressed in coupled in-vitro transcription-translation (IVTT) reactions as described previously (Doolan DL et al., Proteomics. 2008 Nov;8(22):4680-94) and printed onto microarray slides as protein/polypeptide spots representing the individual rubella virus proteins/polypeptides. Larger genes (P150 and P90) were amplified in segments overlapping by 150 nucleotides and expressed on the chip as three spots of overlapping polypeptides/fragments for P150 (i.e., P150s1, P150s2, and P150s3), and three spots for P90 (i.e., P90s1, P90s2, and the whole P90). Glycoproteins E1 and E2, and the capsid C protein were expressed on the chip as single spots.
Label
Biotin
Label protocol
After the overnight incubation, microarray slides were incubated in Fc-specific Biotin-SP-Conjugated Affini-Pure Goat Ant-Human IgG secondary Ab (Jackson ImmunoResearch, Inc.; West Grove, PA).
Hybridization protocol
Bound antibodies were detected by incubation with streptavidin-conjugated SureLight® P3 (Columbia Biosciences; Columbia, MD).
Scan protocol
The array slides were scanned using a GenePix® 4300 Microarray Scanner (Molecular Devices; San Diego, CA) and quantified using GenePix® Pro 7 Microarray Acquisition and Analysis Software (Molecular Devices; Sunnyvale, CA) with spot-specific background correction.
Description
raw_data.csv - Sample 65 Serum samples were run in triplicate against rubella nine rubella virus proteins/polypeptides (i.e., E1, E2, and C rubella virus proteins, three spots of overlapping polypeptides/fragments for P150 [i.e., P150s1, P150s2, and P150s3], and three spots for P90 [i.e., P90s1, P90s2, and the whole P90] on the proteome microarray chip (Antigen Discovery, Inc., Irvine, CA). No DNA(expressed protein) spots were used for negative control for each serum sample.
Data processing
All samples were run in triplicate against nine proteins/polypeptides and the median values were calculated and normalized for background effects.