NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL9341 Query DataSets for GPL9341
Status Public on Nov 13, 2009
Title Mouse 4K miRNA LC_MRA-1002_miRMouse_14
Technology type in situ oligonucleotide
Distribution commercial
Organism Mus musculus
Manufacturer LC Sciences
Manufacture protocol Arrays are made based µParaflo microfluidic technology (Atactic Technologies). On the µParaflo microfluidic chip, each detection probe consists of a chemically modified nucleotide coding segment complementary to target microRNA (from miRBase, http://microrna.sanger.ac.uk/sequences/) or other RNA (control or customer defined sequences) and a spacer segment of polyethylene glycol to extend the coding segment away from the substrate. The detection probes are made by in situ synthesis using PGR (photogenerated reagent) chemistry.
Catalog number MA1002
Support silicon
 
Description Mouse miRNA microarray with 100% coverage of mature miRNAs listed in miRBase version 14
 
Web link http://www.LCsciences.com
Contributor(s) Eicken C
Submission date Oct 01, 2009
Last update date Apr 04, 2012
Contact name Christoph Eicken
E-mail(s) ceicken@lcsciences.com
Phone +1 (713) 664-7087
Organization name LC Sciences, LLC
Street address 2575 W. Bellfort
City Houston
State/province TX
ZIP/Postal code 77054
Country USA
 
Relations
Alternative to GPL15409

Data table header descriptions
ID
MetaRow MetaRow
MetaColumn MetaColumn
Row Row of the probe position on the chip
Column Column of the probe position on the chip
Reporter Name Name of the probe on the chip
Reporter BioSequence Database Entry[mirna] miRBase accession code of the targeted miRNA of the probe on the chip
Reporter BioSequence Type BioSequence type of the probe on the chip
Reporter BioSequence Polymer Type BioSequence polymer type of the probe on the chip
Reporter Group [role] General function of the particular probe on the chip: experimental / control
Reporter Control Type Specific function of the particular probe on the chip
Reporter Comment Target sequence (5' to 3') of the probe
miRNA_ID
SPOT_ID

Data table
ID MetaRow MetaColumn Row Column Reporter Name Reporter BioSequence Database Entry[mirna] Reporter BioSequence Type Reporter BioSequence Polymer Type Reporter Group [role] Reporter Control Type Reporter Comment miRNA_ID SPOT_ID
1 1 1 1 1 empty Control control_empty --control_empty
2 1 1 1 2 mmu-let-7a MIMAT0000521 ss_oligo DNA Experimental Target seq (5' to 3') UGAGGUAGUAGGUUGUAUAGUU mmu-let-7a
3 1 1 1 3 mmu-miR-139-3p MIMAT0004662 ss_oligo DNA Experimental Target seq (5' to 3') UGGAGACGCGGCCCUGUUGGAG mmu-miR-139-3p
4 1 1 1 4 mmu-miR-191 MIMAT0000221 ss_oligo DNA Experimental Target seq (5' to 3') CAACGGAAUCCCAAAAGCAGCUG mmu-miR-191
5 1 1 1 5 mmu-miR-200c* MIMAT0004663 ss_oligo DNA Experimental Target seq (5' to 3') CGUCUUACCCAGCAGUGUUUGG mmu-miR-200c*
6 1 1 1 6 mmu-miR-293 MIMAT0000371 ss_oligo DNA Experimental Target seq (5' to 3') AGUGCCGCAGAGUUUGUAGUGU mmu-miR-293
7 1 1 1 7 mmu-miR-344 MIMAT0000593 ss_oligo DNA Experimental Target seq (5' to 3') UGAUCUAGCCAAAGCCUGACUGU mmu-miR-344
8 1 1 1 8 mmu-miR-465b-5p MIMAT0004871 ss_oligo DNA Experimental Target seq (5' to 3') UAUUUAGAAUGGUGCUGAUCUG mmu-miR-465b-5p
9 1 1 1 9 mmu-miR-574-5p MIMAT0004893 ss_oligo DNA Experimental Target seq (5' to 3') UGAGUGUGUGUGUGUGAGUGUGU mmu-miR-574-5p
10 1 1 1 10 mmu-miR-707 MIMAT0003497 ss_oligo DNA Experimental Target seq (5' to 3') CAGUCAUGCCGCUUGCCUACG mmu-miR-707
11 1 1 1 11 empty Control control_empty --control_empty
12 1 1 1 12 mmu-miR-125b-3p MIMAT0004669 ss_oligo DNA Experimental Target seq (5' to 3') ACGGGUUAGGCUCUUGGGAGCU mmu-miR-125b-3p
13 1 1 1 13 mmu-miR-186 MIMAT0000215 ss_oligo DNA Experimental Target seq (5' to 3') CAAAGAAUUCUCCUUUUGGGCU mmu-miR-186
14 1 1 1 14 mmu-miR-1964 MIMAT0009437 ss_oligo DNA Experimental Target seq (5' to 3') CCGACUUCUGGGCUCCGGCUUU mmu-miR-1964
15 1 1 1 15 mmu-miR-220 MIMAT0004863 ss_oligo DNA Experimental Target seq (5' to 3') CCACCACAGUGUCAGACACUU mmu-miR-220
16 1 1 1 16 mmu-miR-324-3p MIMAT0000556 ss_oligo DNA Experimental Target seq (5' to 3') CCACUGCCCCAGGUGCUGCU mmu-miR-324-3p
17 1 1 1 17 mmu-miR-425 MIMAT0004750 ss_oligo DNA Experimental Target seq (5' to 3') AAUGACACGAUCACUCCCGUUGA mmu-miR-425
18 1 1 1 18 mmu-miR-496 MIMAT0003738 ss_oligo DNA Experimental Target seq (5' to 3') UGAGUAUUACAUGGCCAAUCUC mmu-miR-496
19 1 1 1 19 mmu-miR-679 MIMAT0003455 ss_oligo DNA Experimental Target seq (5' to 3') GGACUGUGAGGUGACUCUUGGU mmu-miR-679
20 1 1 1 20 mmu-miR-877 MIMAT0004861 ss_oligo DNA Experimental Target seq (5' to 3') GUAGAGGAGAUGGCGCAGGG mmu-miR-877

Total number of rows: 3968

Table truncated, full table size 473 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap