 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Dec 01, 2014 |
| Title |
ribosome_footprints_2 |
| Sample type |
SRA |
| |
|
| Source name |
P. falciparum parasites
|
| Organism |
Plasmodium falciparum |
| Characteristics |
Stage: Early Trophozoites
strain: W2
|
| Treatment protocol |
Cells were synchronized by two consecutive sorbitol treatments for three generations, for a total of six treatments. Maximum invasion, point at which half of the culture is either rings or schizonts, was defined as hour zero and independent timepoints were harvested 2, 10, 19, 31 and 46 hours later.
|
| Growth protocol |
W2 strain cultures were maintained in Hyperflasks (Corning) in 500 ml RPMIc (RPMI 1640 media supplemented with 0.25% Albumax II (GIBCO), 2 g/l sodium bicarbonate, 0.1 mM hypoxanthine, 25 mM HEPES (pH 7.4), and 50 μg/l gentamycin), at 37°C, 5% O2, and 6% CO2, to maximum 10-15% parasitemia at 5% HC and frequent media changes (at least every 6-8 hours).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Cultures were incubated for 5 min in 500 ml 37ºC RPMIc, 100µg/ml cycloheximide (Acros Organics) and harvested by centrifugation for 8 min at 3.65 xg at room temperature. An aliquot was removed and flash frozen in lN2 for total total RNA purification and mRNA-Seq library preparation. RBCs were lysed with ice-cold 0.1% saponin in 1X PBS, 100ug/ml cicloheximide. Parasites were resuspended in ice-cold parasite lysis buffer (15 mM KOAc, 15 mM MgOAc, 10 mM Tris HCl pH 7.4, 0.5 mM DTT, 0.5% Triton X-100, 100 ug/ml cyclohexamide) and dripped into a conical tube filled with, and immersed in, lN2. Frozen cells transferred placed in lN2 pre-chilled chambers and pulverized for 3 min at 15 Hz, on a Retsch MM301 mixer mill. Pulverized cells were thawed on ice and cell debris was removed by centrifugation at 4ºC, 16000 xg for 10 min. The polysome-containing supernatant was treated with 2.88 U/ug Micrococcal nuclease for 30 min at room temperature and immediately loaded onto sucrose gradients. Ribosome footprints were extracted from sucrose gradient monosome peak fractions.
Libraries were prepared as in Ingolia et al. Science 2009
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
library strategy: ribo-seq
|
| Data processing |
Basecalling performed using Casava 1.8.
Sequenced reads were trimmed for linker sequence (CTGTAGGCACCATCAATTCGTATGCCGTCTTCTGCTTG). Reads aligning to rRNA ant tRNA sequences were filtered using bowtie 0.12.1. Remaining sequences were uniquely mapped allowing no mismatches to 3D7_derived_W2_genome.fa using bowtie 0.12.1
Wig files were created from bowtie alignments using bowtie 0.12.1 and custom python code.
UTRs were annotated using a Hidden Markov Model on the corresponding mRNA wig files.
Genome_build: PlasmoDB version 7.0 and W2 sequencing (SRP042946)
Supplementary_files_format_and_content: Abundance measurement files are tab delimited and contain 2 columns, one for gene ID and one for RPKM, calculated as described in Mortazavi et al. Nature Methods 2008.
Supplementary_files_format_and_content: Wig files contain normalized read coverage.
Supplementary_files_format_and_content: bed files describe the coordinates for the HMM-discovered UTRs.
|
| |
|
| Submission date |
Jun 11, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Joseph DeRisi |
| Organization name |
UCSF
|
| Department |
Biochemistry
|
| Lab |
DeRisi
|
| Street address |
1700 4th Street
|
| City |
San Francisco |
| State/province |
CA |
| ZIP/Postal code |
94134 |
| Country |
USA |
| |
|
| Platform ID |
GPL16607 |
| Series (1) |
| GSE58402 |
Ribosome Profiling in P. falciparum asexual blood stages |
|
| Relations |
| BioSample |
SAMN02850774 |
| SRA |
SRX590173 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1410297_ribosome_footprints_2_minus.wig.gz |
6.2 Mb |
(ftp)(http) |
WIG |
| GSM1410297_ribosome_footprints_2_plus.wig.gz |
6.2 Mb |
(ftp)(http) |
WIG |
| GSM1410297_ribosome_footprints_2_rpkm.txt.gz |
26.2 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
