|
| Status |
Public on May 01, 2024 |
| Title |
PRS5 |
| Sample type |
SRA |
| |
|
| Source name |
T. brucei cells
|
| Organism |
Trypanosoma brucei brucei TREU927 |
| Characteristics |
cell type: T. brucei cells
developmental stage: Procyclic
developmental stage: Procyclic
fraction: small RNAs
|
| Treatment protocol |
RNA was subjected to fragmentation using Benzonase and several steps of oxidation, β-elimination, and dephosphorylation, thus allowing the enrichment of Nm at 3'-end of fragmented RNAs.
|
| Growth protocol |
Trypanosoma brucei parasites were grown in SDM-79 medium supplemented with 10% fetal calf serum at 27oC.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Whole cell extracts were prepared from 5x10^9 T. brucei cells in a buffer containing 24 mM KCl, 20 mM Tris-pH7.8 and 10 mM MgCl2. RNPs were extracted with 300 mM KCl, and the ribosomes were removed by centrifugation for 3 hr at 35,000 rpm in a Beckman 70.1Ti rotor (150000 x g). The supernatant containing the post-ribosomal supernatant (PRS) was deproteinized by digestion with proteinase K (Roche) (100 ug/ml in 1% SDS for 30 min at 37oC), and RNA was prepared using TRIzol (Sigma) reagent.
Libraries were created following the updated RibOxi-seq protocol (https://link.springer.com/protocol/10.1007%2F978-1-0716-1851-6_22). Fragmentation step was modified to use 250ng small RNA for benzonase digestion with fragmentation of 30 minutes instead of the much longer reaction time the original protocol calls for.
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Library strategy: RibOxi-seq
Paired end reads are first merged into single reads using bbmerge (v38.86) with a correction step (bbmerge-auto.sh ecco=t mix=t) before actual merging (bbmerge-auto.sh minoverlap=6 mininsert=20 mininsert0=20).
Partial 3' adapter is removed using cutadapt v2.10 (cutadapt --discard-untrimmed --minimum-length 20 -a CTGTAGGCACCATCAATGAC -e 0.1 ), followed by moving the 5' random quadruplemer to read identifier line using move-umi.py from the riboxi-seq pipeline (move_umi.py -l 4 -i ATCACG -a ATCACGCTGTAGGCACCATCAATGAC -m 'pipeline'). Finally, cutadapt is used once again to remove reads that does not contain a fixed barcode at 3' end (cutadapt --discard-untrimmed --minimum-length 20 -a ATCACG -e 0.01 ).
Trypanosoma brucei brucei TREU927 small RNA transcript sequences were used to build STAR index (STAR version 2.7.5c). The Alignment was then done with STAR (STAR --outMultimapperOrder Random --outFilterMismatchNoverLmax 0.1 --alignEndsType EndToEnd --outSAMtype BAM SortedByCoordinate)
samtools is then used to index the resulting bam files before running umi_tools v1.01 to deduplicate aligned reads.
bedtools v2.29.2 was used with bamtobed option to generate bed files for each sample. The bedfiles were then loaded in R and all rows with "-" strands were removed. Reads 3' counts were calculated by summing up all rows that have the same "end" positions. Mean riboxi score for each position is then calculated by first calculating score per position for each sample (position/(average(position-1, position+1)+1)) followed by average each position across all samples. Candidate sites are called using mean counts of 10 and score-mean of 4.
Supplementary_files_format_and_content: Raw 3' end counts
Supplementary_files_format_and_content: candidate sites with scores
|
| |
|
| Submission date |
Nov 01, 2021 |
| Last update date |
May 01, 2024 |
| Contact name |
Christopher L Holley |
| Organization name |
Duke University
|
| Street address |
2301 Erwin Rd
|
| City |
Durham |
| State/province |
NC |
| ZIP/Postal code |
27705 |
| Country |
USA |
| |
|
| Platform ID |
GPL30921 |
| Series (1) |
| GSE186967 |
Mapping of 2'-O-methylation in Trypanosoma brucei small RNAs using RibOxi-seq |
|
| Relations |
| BioSample |
SAMN22825821 |
| SRA |
SRX12885997 |
