 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 07, 2022 |
| Title |
scNanoATAC_GM12878 |
| Sample type |
SRA |
| |
|
| Source name |
GM12878
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: GM12878
|
| Growth protocol |
K526 cells were cultured in RPMI-1640 (Gibco; 11875093) supplemented with 10% fetal bovine serum (Gibco; 26140079). HEK293T, HFF1 and MEF cells were cultured in DMEM (Gibco; 11995040) supplemented with 10% fetal bovine serum. GM12878 cells were cultured in RPMI-1640 supplemented with 15% fetal bovine serum. eHAP1 cells were cultured in IMDM (Gibco; 12440053) supplemented with 10% fetal bovine serum. Mouse embryonic stem cells (mESCs) were cultured without feeders in equal volume of Dulbecco’s modified eagle’s medium (DMEM/F-12, Gibco; 11320033) and Neurobasal Medium (Gibco; 21103049) supplemented with 1,000 U/ml leukemia inhibitory factor (LIF, Millipore, ESG1107), 0.5× N-2 (Gibco, 17502048), 0.5× B-27 (Gibco, 10889038), 50 μg/ml Bovine Serum Albumin (BSA, Sigma-Aldrich, A3311), 2 mM L-Glutamine (Gibco, 2503081), 0.1 mM β-Mercaptoethanol (Sigma-Aldrich, M7522), 1× MEM Non-Essential Amino Acids Solution (NEAA, Gibco, 11140050), 100 U/ml Penicillin and 0.1mg/ml Streptomycin (Gibco, 15140122).
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Cells (100,000-200,000 cells before freezing) were quickly thawed at 37℃ and centrifuged at 500 g for 5 min at 4℃. Then nuclei were isolated with Omni-ATAC lysis buffer (10 mM Tris-HCl (pH 7. 4), 10 mM NaCl, 3 mM MgCl2, 0.1% IGEPAL CA630, 0.1% Tween-20, 0.01% digitonin) and incubated on ice for 3-5 min.
Nuclei were tagmentated with customized Tn5 transposome which was embed with one adaptor sequence. The reaction was incubated on a thermomixer at 800 rpm, 37℃,30 min and stopped by tagmentation stop buffer. Single nucleus stained with DAPI was flow sorted into each plate well containing lysis buffer and then incubated at 65 °C for 30 min. SDS was quenched with 4μL 10% Tween-20, and PCR was performed using PrimeSTAR GXL DNA Polymerase. Then thermal cycled as follows: 68°C for 10 min, 95°C for 1 min, 16 cycles of 94°C for 15 s, 63°C for 30 s, 68°C for 8 min and finally 68 °C for 5 min. 48 wells with different inner barcodes were pooled and purified with 1X AMPure XP beads. Another four cycles of amplification was carried out in a 50 µL GXL DNA Polymerase system with 1 μM Outer Primer. The amplified products were purified with 1X AMPure XP beads twice. 20 products with different outer barcodes (960 cells in total) were pooled together and sequenced on one MinION flow cell (Oxford Nanopore Technologies; R9.4.1).
|
| |
|
| Library strategy |
ATAC-seq |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
PromethION |
| |
|
| Description |
Single-cell long-read ATAC-seq of GM12878
|
| Data processing |
To call fastq from electric signals of Oxford Nanopore sequencing, we used MinKNOW (v20.06.18), MinKNOW Core (v4.0.5), Bream (v6.0.10), and Guppy (v4.0.11).
Single cells of each library were demultiplexed by nanoplexer (v0.1). According to our double barcode design of library structure, demultiplexing were performed twice on outer and inner barcodes in succession.
Adaptors of single-cell demultiplexed reads were removed by cutadapt (v3.2). The adaptor sequences include 'TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG' at 5' ends and 'CTGTCTCTTATACACATCTCCGAGCCCACGAGA' at 3' ends. Once at least 12 bases on each read were matched with adaptor sequences, those bases were to be removed. As sequencing error is common for long-read sequencing, the mismatch error tolerance of base matching was set as 0.2. We also filtered reads shorter than 1Kb, which are rare in our long-read libraries.
Trimmed reads were aligned to reference genome in 'map-ont' mode by minimap2 (v2.17-r941). Reads with mapping quality less than 30 were filtered by samtools (v1.10). PCR duplicates were removed by single cell with 'samtools rmdup'.
To generate chromatin accessibility signal, single-cell long ATAC-seq mapped reads were converted from bam to bed by 'bamtobed' command of bedtools (v2.30.0). Then both ends of each read were extracted by 'bedtools flank' command with 1 bp flanking size. Those ends of reads are regarded as chromatin accessibility signal and merged by single cell into fragment files for each library.
Fragment files of libraries were input to ArchR (v1.0.2) to generate arrow files with 'createArrowFiles' function.
In ArchR analysis of single-cell ATAC-seq signal, cells with fragment count > 10k and TSS enrichment > 1 were kept. Pseudo bulk coverage tracks by cell line were generated by 'addGroupCoverages' function. Peak calling sets by cell line were calculated by 'addReproduciblePeakSet' function with 0.01 as adjusted P value cut-off.
We phased long reads from scNanoATAC-seq library of GM12878 by 'haplotag' command of whatshap (v1.2.1) based on the benchmark SNP from GIAB. We test significance of bias on each peak of GM12878 by 'binom.test(c(mat, pat), p=0.5)' in R, where 'mat' and 'pat' are counts of allele-specific ends inside each peak.
After testing all candidate peaks, we made multiple test corrections with methods of Benjamini-Hochberg, and the FDR was set to 0.05. Significantly biased peaks were divided into paternal or maternal peaks according to the strength of accessibility by haplotype.
Genome_build: hg38 for human; mm10 for mouse
Supplementary_files_format_and_content: Bigwig files recorded ATAC-seq signal strength tracks. Bed files recorded coordinates of ATAC-seq peaks called by MACS2 (`-llocal 500000`).
|
| |
|
| Submission date |
Jan 19, 2022 |
| Last update date |
Sep 07, 2022 |
| Contact name |
Fuchou Tang |
| E-mail(s) |
tangfuchou@pku.edu.cn
|
| Organization name |
Biomedical Pioneering Innovation Center, Peking University
|
| Street address |
No.5 Yiheyuan Road, Haidian District
|
| City |
Beijing |
| State/province |
Beijing |
| ZIP/Postal code |
100871 |
| Country |
China |
| |
|
| Platform ID |
GPL26167 |
| Series (2) |
| GSE194022 |
scNanoATAC-seq: Long-read Single-cell ATAC-seq by Oxford Nanopore Technologies Sequencing [DataSet1: scNanoATAC-seq] |
| GSE194024 |
scNanoATAC-seq: Long-read Single-cell ATAC-seq by Oxford Nanopore Technologies Sequencing |
|
| Relations |
| BioSample |
SAMN25125418 |
| SRA |
SRX13834328 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM5825630_GM12878-TileSize-100-normMethod-nFrags-ArchR.bw |
112.0 Mb |
(ftp)(http) |
BW |
| GSM5825630_GM12878.bed.gz |
456.9 Kb |
(ftp)(http) |
BED |
| GSM5825630_GM12878_long-read_maternal-specific_peaks.bed.gz |
2.4 Kb |
(ftp)(http) |
BED |
| GSM5825630_GM12878_long-read_paternal-specific_peaks.bed.gz |
1.4 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
