|
| Status |
Public on Mar 05, 2022 |
| Title |
BEAF_RNAi_Rep2_PRO |
| Sample type |
SRA |
| |
|
| Source name |
S2 cells
|
| Organism |
Drosophila melanogaster |
| Characteristics |
RNAi: BEAF
|
| Treatment protocol |
Cells at 5 x 10 6 cells/ml were diluted 5- fold with serum-free M3 + BPYE + anti/anti and 150 μg dsRNA was added to 15 ml cells in T150 flasks. After incubating 45 min at 25⁰C, 15 ml of the same medium supplemented with 20% FBS was added to the cells. After 2.5 days another 150 μg dsRNA was added followed by 30 ml M3 + BPYE, anti/anti and 10% FBS, and the cells were split into two new flasks. After another 2.5 days the cells were harvested for isolation of nuclei. Synthesis of dsRNA used a dsDNA template with a T7 RNA polymerase promoter on both ends. The dsRNA was 668 bp for BEAF, 493 bp for Pbro, and 835 bp for LacZ. The DNA templates were generated by PCR using the following primers: BEAF forward (CTAATACGACTCACTATAGGGAGCAAGGCCAAGACGCTGAG); BEAF reverse (CTAATACGACTCACTATAGGGAGCGCTGATTTGCCCATTTAC); Pbro forward (CTAATACGACTCACTATAGGGAGCACTACTACGACATTATCAGGG); Pbro reverse (CTAATACGACTCACTATAGGGAGCTCTGTGCGGGACAACTTTC); control LacZ forward (GAATTAATACGACTCACTATAGGGAGAGATATCCTGCTGATGAAGC); LacZ reverse (GAATTAATACGACTCACTATAGGGAGAGCAGGAGCTCGTTATCGC).
|
| Growth protocol |
S2 cell tissue culture and RNAi treatment Drosophila S2 cells were grown at 25⁰C in M3 + BPYE medium with 10% fetal bovine serum (FBS) and antibiotic/antimycotic (anti/anti; 100 U/ml penicillin, 0.1 mg/ml streptomycin, 250 ng/ml amphotericin B) from 5 x 10e5 to 10e7 cells/ml.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Nuclei were isolated as in (KWAK et al. 2013)
PRO-seq library preparation: Nuclei were isolated and PRO-seq libraries were prepared as previously described using 10 PCR cycles after adaptor addition and reverse transcription (KWAK et al. 2013; MAHAT et al. 2016).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Data processing |
Library strategy: PRO-seq
Libraries were sequenced by the Cornell Biotechnology Resource Center on an Illumina NextSeq 500. The six bar-coded PRO-seq libraries (biological replicates of the 3 RNAi treatments) were pooled and 75 nucleotide reads were obtained. The six bar-coded MNase-seq libraries were pooled and 2 x 32 nucleotide paired-end reads were obtained.
Fastq was aligned to the Drosophila melanogaster dm3 reference genome with up to 2 mismatches using Bowtie (LANGMEAD 2010) Parameters: bowtie -p9 -v2 -M1 -q --sam
PRO-seq Fastq files were processed using the FastX toolkit (hannonlab.cshl.edu/fastx_toolkit/index.html) to filter, clip the Illumina adapters (fastx_clipper), trim to 26-mers (fastx_trimmer), and aligned to the Drosophila melanogaster dm3 reference genome with up to 2 mismatches using Bowtie (LANGMEAD 2010). Parameters: bowtie -p9 -v2 -M1 -q --sam
PRO-seq reads correspond to the sense strand of RNA, so were converted to their reverse complement before alignment. A summary of sequencing yields and the number of reads that uniquely mapped to the genome is given in Supplemental Table 2. Replicates were highly correlated (Supplemental Figure 1) and combined for further analyses except for DESeq2. Sequence data were deposited at NCBI Gene Express Omnibus (GEO) under accession number xxxxxx. Using a list of 9452 non-overlapping genes (CORE et al. 2012), custom scripts were used with PRO-seq data to count promoter-proximal (50 bp window with the most reads from -50 to 150 relative to the annotated TSS) and gene body (from 200 bp downstream of the TSS to 200 bp upstream of the annotated gene end) Pol II sequence reads and to calculate pausing indexes.
Custom scripts: https://github.com/McKowen-JK/BEAF_Pbro
Genome_build: dm3
Supplementary_files_format_and_content: bigwig, DESeq2 results
|
| |
|
| Submission date |
Feb 28, 2022 |
| Last update date |
Mar 06, 2022 |
| Contact name |
Craig Hart |
| E-mail(s) |
keller.mckowen@gmail.com, chart4@lsu.edu
|
| Phone |
225-578-7389
|
| Organization name |
Louisiana State University
|
| Department |
Biological Sciences
|
| Lab |
Hart
|
| Street address |
Life Science Building, LSU
|
| City |
Baton Rouge |
| State/province |
Louisiana |
| ZIP/Postal code |
70808 |
| Country |
USA |
| |
|
| Platform ID |
GPL19132 |
| Series (2) |
| GSE197579 |
The Drosophila BEAF Insulator Protein Interacts with the Polybromo Subunit of the PBAP Chromatin Remodeling Complex [PRO-seq] |
| GSE197584 |
The Drosophila BEAF Insulator Protein Interacts with the Polybromo Subunit of the PBAP Chromatin Remodeling Complex |
|
| Relations |
| BioSample |
SAMN26309674 |
| SRA |
SRX14311246 |
