GEO Profile Links for Gene (Select 23850) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 20 of 1217

<< First< Prev

Page of 61

Next >Last >>

Select item 941149571.

Pappa2 - Ascorbic acid effect on Mc3T3 osteoblasts

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS4505, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 94114957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 737074572.

Pappa2 - Trophoblast stem cell differentiation in vitro

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3948, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 14 samples

ID:: 73707457

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 763631573.

Pappa2 - High-density lipoproteins effect on pancreatic β cells subjected to apoptotic stimuli

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS4026, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 24 samples

ID:: 76363157

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 563145574.

Pappa2 - Protocadherin 12 deficiency effect on the placenta

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3415, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 56314557

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 683309575.

Pappa2 - von Hippel-Lindau (VHL) tumor suppressor protein deficiency effect on pancreatic islet cells

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3800, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 68330957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 706238576.

Pappa2 - Embryonic development of male reproductive tract tissues

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3862, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 70623857

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1297324957.

Pappa2 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359266 (ID_REF), GDS5645, NM_001085376, BC094560, chr1:158711731-158832855 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129732495

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1240907578.

Pappa2 - Sodium tungstate effect on insulin receptor substrate 2 knockout mice: pancreatic islets

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS5380, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124090757

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 667791969.

Pappa2 - Skin-derived precursors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359280 (ID_REF), GDS3753, NM_001085376, AK005504, chr1:158834750-158834943 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 66779196

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6677919710.

Pappa2 - Skin-derived precursors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359282 (ID_REF), GDS3753, NM_001085376, chr1:158838544-158957438 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 66779197

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6677919511.

Pappa2 - Skin-derived precursors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359266 (ID_REF), GDS3753, NM_001085376, BC094560, chr1:158711731-158832855 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 66779195

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4988275712.

Pappa2 - Various tissues

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3142, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 70 samples

ID:: 49882757

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12973249713.

Pappa2 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359282 (ID_REF), GDS5645, NM_001085376, chr1:158838544-158957438 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129732497

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7528465714.

Pappa2 - Pancreatic islet beta-cell expression after isolation: time course

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3991, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, transformed count, 17 samples

ID:: 75284657

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11425895715.

Pappa2 - Glucose effect on young and aged pancreatic islets: dose response

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS4939, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 20 samples

ID:: 114258957

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12973249616.

Pappa2 - v-raf murine sarcoma viral oncogene homolog B-mutant thyroid carcinoma tumors

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL6246, 10359280 (ID_REF), GDS5645, NM_001085376, AK005504, chr1:158834750-158834943 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 10 samples

ID:: 129732496

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6867985717.

Pappa2 - TNF receptor and lymphotoxin beta -receptor activation effect on aortic endothelial cells in vitro

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3810, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 5 samples

ID:: 68679857

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4399535718.

Pappa2 - Various brain regions of several inbred strains

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS2917, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 61 samples

ID:: 43995357

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 4883305719.

Pappa2 - Alpha 2B-adrenoceptor deficient embryo and its placenta

Annotation:: Pappa2, pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1261, 1444451_at (ID_REF), GDS3108, 23850 (Gene ID), BB101283

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 48833057

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 746286320.

Pappa2 - MPSS transcriptome analysis project

Annotation:: Pappa2, Pappalysin 2

Organism:: Mus musculus

Reporter:: GPL1010, GATCCCTCTCTGGTGCACTG (ID_REF), GDS868, CF745327

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7462863

GEO DataSets Gene Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 61

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profile Links for Gene (Select 23850) (1217)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Gene

Items: 1 to 20 of 1217

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity