GEO Profiles Links for Nucleotide (Select 18043295) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 151

<< First< Prev

Page of 8

Next >Last >>

Select item 74637461.

Sin3b - MPSS transcriptome analysis project

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTACACACCTACCAGA (ID_REF), GDS868, BC020049

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7463746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 76014462.

Sin3b - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL1010, GATCCTACACACCTACCAGA (ID_REF), GDS878, BC020049

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7601446

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 44810603.

Fam32a - Zygotic gene activation

Annotation:: Fam32a, family with sequence similarity 32, member A (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11960 (ID_REF), GDS579, AF038848, AK087970, BC020049, BC021160, BC051536, BC006058, H3129D02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 36 samples

ID:: 4481060

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1087103464.

Sin3b - Ubiquitin specific protease 22 depletion effect on embryonic stem cell line

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4973, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 4 samples

ID:: 108710346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 996779465.

Sin3b - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4578, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99677946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 968439466.

Sin3b - Heterozygous null CREB binding protein mutant response to environmental enrichment: hippocampus

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4486, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 16 samples

ID:: 96843946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 755638467.

Sin3b - Regulatory, pathogenic and control CD4+ T cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS3999, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 8 samples

ID:: 75563846

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 875077468.

Sin3b - Iroquois homeobox Irx3 and Irx5 deletion effect on embryonic heart

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4317, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 14 samples

ID:: 87507746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1078559469.

Sin3b - Estrogen effect on male and female haematopoietic stem cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4944, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 107855946

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 445776010.

Fam32a - Preimplantation development

Annotation:: Fam32a, family with sequence similarity 32, member A (multiple annotations exist)

Organism:: Mus musculus

Reporter:: GPL870, 11960 (ID_REF), GDS578, AF038848, AK087970, BC020049, BC021160, BC051536, BC006058, H3129D02-3_rev (CLONE ID)

DataSet type:: Expression profiling by array, log ratio, 28 samples

ID:: 4457760

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 8963074611.

Sin3b - Lung epithelium response to fungal allergen Alternaria

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4423, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 89630746

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 6680244612.

Sin3b - Skin-derived precursors

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS3753, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 66802446

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7213024613.

Sin3b - Directed differentiation of embryonic stem cells and induced pluripotent stem cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS3904, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 30 samples

ID:: 72130246

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7937054614.

Sin3b - Diabetogenic 3A9 T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4115, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 79370546

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7539054615.

Sin3b - Developing testis and ovary

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS3995, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 91 samples

ID:: 75390546

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11236364616.

Sin3b - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS5092, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112363646

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9744234617.

Sin3b - Model for the manic pole of bipolar disorder: hippocampus

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4517, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 97442346

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7940724618.

Sin3b - Diabetogenic BDC T-cell transfer model of type I diabetes: pancreatic islets

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4116, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 79407246

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11440804619.

Sin3b - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS4948, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114408046

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 7511304620.

Sin3b - Segmented filamentous bacteria gut colonization effect on nonobese diabetic mice: T cells

Annotation:: Sin3b, transcriptional regulator, SIN3B (yeast)

Organism:: Mus musculus

Reporter:: GPL6246, 10572838 (ID_REF), GDS3987, NM_001113248, NM_009188, AF038848, AK087970, AK173005, BC020049, BC021160, L38622, XM_006530789, chr8:72723298-72757405 (SPOT ID)

DataSet type:: Expression profiling by array, count, 26 samples

ID:: 75113046

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 18043295) (151)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 151

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity