GEO Profiles Links for Nucleotide (Select 31419641) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 145

<< First< Prev

Page of 8

Next >Last >>

Select item 1318776421.

Thrsp - Short-term high fat diet effect on epididymal adipose fractions: time course

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS5824, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 18 samples

ID:: 131877642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1029375422.

Thrsp - Liver response to a high fat diet: time course

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4783, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 36 samples

ID:: 102937542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 74773553.

Thrsp - MPSS transcriptome analysis project

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGTAGGAAGCACAGGT (ID_REF), GDS868, BC053378

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7477355

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1181696424.

Thrsp - Age effect on adipocytes of the bone marrow and epididymis

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS5226, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 118169642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1055003425.

Thrsp - Streptozotocin induced type 1 diabetes: liver

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4845, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 13 samples

ID:: 105500342

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 969804426.

Thrsp - Lmna G609G knock-in model of Hutchinson-Gilford Progeria Syndrome: liver

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4490, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 6 samples

ID:: 96980442

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 666592427.

Thrsp - Peroxisome proliferator-activated receptor alpha deficiency effect on phthalate-exposed liver

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS3748, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 15 samples

ID:: 66659242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1320339428.

Thrsp - Nebulin deficiency effect on the quadriceps

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS5880, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 132033942

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 1068160429.

Thrsp - Pancreatic cancer-induced cachexia model: muscle, liver and white adipose tissue

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4899, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 106816042

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 9277714210.

Thrsp - Neurofibromin inactivation effect on triceps muscle

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4447, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 92777142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 761505511.

Thrsp - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL1010, GATCAGTAGGAAGCACAGGT (ID_REF), GDS878, BC053378

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7615055

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 12234774212.

Thrsp - Death receptor knockout effect on NEMO-deficient model of chronic liver disease

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS5332, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 11 samples

ID:: 122347742

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8122764213.

Thrsp - Conditional GBA1 deletion model of Type 1 Gaucher Disease: liver and spleen

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4162, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, count, 7 samples

ID:: 81227642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10420424214.

Thrsp - SIRT3 deficient liver response to a high fat diet

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4817, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 104204242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10297424215.

Thrsp - Post-pneumonectomy lung regeneration: time course

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4784, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 21 samples

ID:: 102974242

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8728514216.

Thrsp - Sex effect on acute coxsackievirus B3-induced myocarditis: heart

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4311, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 87285142

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 11894854217.

Thrsp - Ankle joint response to the induction of arthritis

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS5244, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 118948542

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 10507074218.

Thrsp - Transcription factor treatment effect on embryonic fibroblasts

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4835, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 28 samples

ID:: 105070742

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8472964219.

Thrsp - DSS-induced colitis model response to enhanced siRNA targeting of Tumor necrosis factor α

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4371, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 36 samples

ID:: 84729642

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

Select item 8991884220.

Thrsp - Sex effect on chronic coxsackievirus B3-induced myocarditis: heart

Annotation:: Thrsp, thyroid hormone responsive

Organism:: Mus musculus

Reporter:: GPL6246, 10565609 (ID_REF), GDS4436, NM_009381, BC009165, BC053378, AK050300, chr7:97412944-97417510 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 89918842

GEO DataSets Gene Profile neighbors Chromosome neighbors Homologene neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 31419641) (145)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 145

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity