GEO Profiles Links for Nucleotide (Select 40353063) - GEO Profiles

Warning: The NCBI web site requires JavaScript to function. more...

Links from Nucleotide

Items: 1 to 20 of 148

<< First< Prev

Page of 8

Next >Last >>

Select item 1143895221.

Serpinb9b - Transforming growth factor beta effect on cytokine-activated, NOD-derived, splenic natural killer cells

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4948, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, count, 9 samples

ID:: 114389522

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1067617222.

Serpinb9b - TGFβ inhibitor effect on induced cardiomyocytes

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4898, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 27 samples

ID:: 106761722

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1050531223.

Serpinb9b - Transcription factor treatment effect on embryonic fibroblasts

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4835, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 28 samples

ID:: 105053122

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1306852224.

Serpinb9b - Glucagon effect on hepatocytes deficient in lysine acetyltransferase 2B or WD repeat-containing protein 5

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5673, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, count, 10 samples

ID:: 130685222

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1143528225.

Serpinb9b - Regulatory T cell ablation effect on BDC2.5/NOD pancreatic or splenic natural killer cells: time course

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4946, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, count, 32 samples

ID:: 114352822

GEO DataSets Gene Chromosome neighbors

Select item 984796226.

Serpinb9b - Pulmonary vascular microendothelial cell response to mutations in type 2 receptor for the bone morphogenetic protein signaling pathway, BMPR2

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4543, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 98479622

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 990356227.

Serpinb9b - Spleen response to acute LCMV-Armstrong and persistent LCMV-Clone13 infections: time course

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4556, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 26 samples

ID:: 99035622

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 1303978228.

Serpinb9b - Pathogen-associated molecular-pattern curdlan effect on interleukin-2 deficient GM-CSF myeloid dendritic cells

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5665, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 130397822

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 826745229.

Serpinb9b - Pluripotent embryonic stem cells and multipotent adult germline stem cells in 129SV and Stra8-EGFP/Rosa26-LacZ strains

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4170, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 18 samples

ID:: 82674522

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12190172210.

Serpinb9b - Embryonic fibroblast response to ectopic expression of transcription factors Oct4, Sox2, Klf4, c-Myc: time course

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5316, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 24 samples

ID:: 121901722

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 9965942211.

Serpinb9b - Lipopolysaccharide-stimulated, NFκB ζ inhibitor (IκBζ) deficient-peritoneal macrophages

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4578, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, count, 12 samples

ID:: 99659422

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12435962212.

Serpinb9b - Transforming growth factor β effect on mammary epithelial NMuMG cells overexpressing major satellite transcripts

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5387, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124359622

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 10312532213.

Serpinb9b - H3K4me3 histone demethylase Fbxl10 overexpression effect on fibroblast cell line

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS4788, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 103125322

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12474562214.

Serpinb9b - RANKL effect on osteoclastogenic cell line

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5398, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 6 samples

ID:: 124745622

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 762865615.

Serpinb9b - MPSS analysis of BLK CL.4 and liver cells

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTATGATGCCTGCTTT (ID_REF), GDS878, BC064768

DataSet type:: Expression profiling by MPSS, count, 6 samples

ID:: 7628656

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 749095616.

Serpinb9b - MPSS transcriptome analysis project

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL1010, GATCTTATGATGCCTGCTTT (ID_REF), GDS868, BC064768

DataSet type:: Expression profiling by MPSS, count, 87 samples

ID:: 7490956

GEO DataSets Gene Chromosome neighbors

Select item 11182952217.

Serpinb9b - Fra-1 deficient lung response to fibrotic agent bleomycin

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5078, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 12 samples

ID:: 111829522

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12419552218.

Serpinb9b - Interleukin-6 effect on interleukin-6 receptor α-deficient macrophages

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5383, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 8 samples

ID:: 124195522

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 12336502219.

Serpinb9b - Normal mammary glands at three developmental stages: adipose stroma

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5361, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, transformed count, 9 samples

ID:: 123365022

GEO DataSets Gene Profile neighbors Chromosome neighbors

Select item 11234512220.

Serpinb9b - Embryonic fibroblast in vitro model of hypothermia: time course

Annotation:: Serpinb9b, serine (or cysteine) peptidase inhibitor, clade B, member 9b

Organism:: Mus musculus

Reporter:: GPL6246, 10404439 (ID_REF), GDS5092, NM_011452, BC064768, U96705, chr13:33027414-33040581 (SPOT ID)

DataSet type:: Expression profiling by array, count, 13 samples

ID:: 112345122

GEO DataSets Gene Profile neighbors Chromosome neighbors

<< First< Prev

Page of 8

Next >Last >>

Supplemental Content

Filters: Manage Filters

Profile data

Find related data

Important Links

Recent activity

Clear Turn Off Turn On

GEO Profiles Links for Nucleotide (Select 40353063) (148)
GEO Profiles

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

You are here: NCBI > Genes & Expression > Gene Expression Omnibus (GEO) Profiles

Support Center

GEO Profiles

Charting Gene Expression Levels

Result Filters

Gene symbol

Gene keyword

Organism

Gene ontology

Differential expression

DataSet keyword

GEO accession

Additional filters

Send to:

Links from Nucleotide

Items: 1 to 20 of 148

Send to:

Supplemental Content

Profile data

Download the value data (red bars) for each profile on this page

Find related data

Important Links

Recent activity