GEO Accession viewer

GSE31404	Expression profiling of LSK cells from Bmi1 cKO mice in hematopoiesis versus LSK control cells from WT mice
GSE32449	Triploid causes genome instability in tumorigenesis
GSE33268	Synergistic, context-dependent and hierarchical functions of hematopoietic progenitor niche components.
GSE34133	Proinflammatory role of histamine-releasing factor in asthma and allergy
GSE34262	Genomewide expression profile of wire-injured carotid arteries harvested from either miR-126+/+/ApoE-/- or miR-126-/-/ApoE-/- mice during neointima development
GSE34843	HDAC inhibitors promote the pro-myogenic activity of Sca1-positive interstitial cells in regenerating dystrophic muscles
GSE35173	Development of mRNA and lincRNA expression signatures of MEFs deficient in ER stress mediators for tunicamycin treatment
GSE35209	Development of mRNA and miRNA expression signatures of MEFs deficient in ER stress mediators for tunicamycin treatment
GSE35289	Placental growth factor as potential target against hepatocellular carcinoma in an orthotopic mouse model.
GSE35560	Transcriptional profiles of transgenic ALK^F1174L/MYCN vs. MYCN tumors
GSE36288	Expression data from LSK cells from mice with knock-out of Ezh1 versus LSK control
GSE36516	Gene expression profiling in Tie-2-Etv2 endothelial and/or hematopoietic precursors
GSE36731	Gene expression profiling in Vav-Etv2 KSL and Granulocyte hematopoietic cells
GSE36788	Gene expression profiling in Tie-2-Etv2 YS hematopoietic precursors
GSE36925	Mouse primary osteoblasts treated with/without BMP2
GSE38810	Gene expression analyses in IRF8-induced monocyte differentiation
GSE38825	IRF8-induced monocyte differentiation
GSE39300	Gene expression changes in embryonic PECAM-1+ cells from Gata2 +9.5 enhancer targeted mice
GSE39455	Polycyclic aromatic hydrocarbons as skin carcinogens: Comparison of benzo[a]pyrene, dibenzo[def,p]chrysene and three environmental mixtures in the FVB/N mouse
GSE39660	Endothelial Cells Provide an Instructive Niche for the Differentiation and Functional Polarization of M2-like Macrophages
GSE39765	Development of gene expression signature for defining the cell potency of muscle derived stem cells (MDSC) from mice of diffferent genotypes
GSE40728	Role of CDK8 in interferon-gamma-induced gene expression
GSE40959	Identifying CHIR99021 and AICAR-regulated genes in the J1 mESCs
GSE41122	EWS/ATF1 activates Fos and induces soft tissue sarcomas from neural crest-derived cells [Agilent].
GSE41123	EWS/ATF1 activates Fos and induces soft tissue sarcomas from neural crest-derived cells.
GSE41412	Gene expression data in mouse fetal lungs
GSE41607	Gene expression data in Mouse Lung Epithelial cells MLE-12 transfected with inhibitors and precursors for miR-30a, miR-30d, miR-23b, miR-125 and miR-337, miR-466a, miR466d, miR-476c, respectively
GSE41736	Murine HIV-gagP24 CD8 T cells: bone marrow vs Lymph node
GSE42285	Host response in the lung to influenza infection with PR8, VN or X31 strains at 12, 16 and 24 hours
GSE42824	Molecular bases for tumor induced exhaustion in CD8 T cells
GSE42860	Sca-1 expression defines different developmental stages of mouse PDC that show functional heterogeneity in the endosomal but not lysosomal TLR9 response
GSE43029	RNASET2-silenced and control OVCAR3 cell clones injected into nude mice.
GSE43103	H4K16 acetylation marks active genes and enhancers of embryonic stem cells, but does not alter chromatin compaction
GSE43171	RAP1 protects from obesity, diabetes and metabolic syndrome through its extra telomeric role regulating gene expression (young mouse liver)
GSE43172	RAP1 protects from obesity, diabetes and metabolic syndrome through its extra telomeric role regulating gene expression (young mouse white fat)
GSE43173	RAP1 protects from obesity, diabetes and metabolic syndrome through its extra telomeric role regulating gene expression (old mouse liver)
GSE43174	RAP1 protects from obesity, diabetes and metabolic syndrome through its extra telomeric role regulating gene expression
GSE43310	Gene expression profile in spleens of mice 24 hours after total body irradiation.
GSE43313	Effects of supernatants of USP2 knockdown HL-60 cells and mock transfected HL60 cells on differentiated 3T3-L1 cells
GSE43405	Identifying vitamin C and RA-regulated genes in the J1 mESCs
GSE43438	Sub-chronic forestomach transcriptional response in adult male MutaTMMouse following oral exposure to benzo(a)pyrene
GSE43500	Global transcriptome analysis on Ankrd2 deficient or overexpressing differentiating primary myoblasts
GSE43508	Comparison of gene expression signature between nascent Lhx6-GFP+ cells from mouse embryonic brain and differentiated Lhx6-GFP+ cells from ES cells (as well as comparing those of Lhx6-GFP+ and Lhx6-GFP- cells from ES cells)
GSE43803	The differentiation stage of p53- and Rb-deficient bone marrow mesenchymal stem cells imposes the phenotype of in vivo sarcoma development (part II)
GSE43804	The differentiation stage of p53- and Rb-deficient bone marrow mesenchymal stem cells imposes the phenotype of in vivo sarcoma development
GSE44274	Gene Expression Analysis of Host Immune Responses in the UV inactivated SARS-CoV-immunized mice following Lethal SARS-CoV Infection
GSE44403	Comparison of B-MSCs from young and old mice
GSE44431	Gene expression profile in spleens of congenic mice 24 hours after total body irradiation.
GSE44920	Gene epxression profiling in murine bone marrow Lin- cells transduced with BCR-ABL and/or IRF8 followed by Flt3L culture for 5 days
GSE45122	MicroRNA-155 confers encephalogenic potential to Th17 cells by promoting IL-23 responsiveness and effector gene expression
GSE45607	Maternal folic acid supplementation alters gene expression in the offspring brain
GSE45841	Sall1CreER E13.5 110228
GSE45845	Sall1 co-operated with Six2 to actively maintain nephron progenitors in the embryonic kidney
GSE46110	Effects of Brazilian propolis on gene expression of stromal cells in mesenteric adipose tissue of ob/ob mice
GSE46163	Gene expression changes in the olfactory bulb of mice induced by exposure to diesel exhaust are dependent on animal rearing environment
GSE46181	Genes involved in plucking induced hair regeneration
GSE46357	Developmental changes in the in vitro activated regenerative activity of primitive mammary epithelial cells
GSE46381	Effect of NDRG1 deletion and hypoxia in mouse placenta
GSE46395	Gene expression in the heart of mouse with myocardial infarction
GSE46548	ISR target genes in muscle of hSA::Fv2E-PERK
GSE46551	Consequences of perinatal bisphenol A exposure in a mouse model of multiple sclerosis
GSE46672	Gene expression profiles for murine submandibular gland stem cells
GSE46998	Transcriptomic analysis of mouse lung tissue exposed to multiwalled carbon nanotubes (Mitsui7)
GSE46999	Transcriptomic analysis of cultured lung epithelial cells exposed to multiwalled carbon nanotubes (Mitsui7)
GSE47000	Transcriptomic analysis reveals novel mechanistic insight into murine biological responses to multi-walled carbon nanotubes in lungs and cultured lung epithelia cells
GSE47155	Hepatic transcriptome of mice with a deletion of the miR-379/miR-410 cluster obtained 4h following a caesarean at embryonic day E19.5
GSE47156	Hepatic transcriptome of mice with a deletion of the miR-379/miR-410 cluster at E19.5 and P0
GSE47159	Hepatic transcriptome of mice with a deletion of the miR-379/miR-410 cluster
GSE47716	H4K16 acetylation marks active genes and enhancers of embryonic stem cells, but does not alter chromatin compaction [Agilent array]
GSE48041	Molecular Basis of Renal Adaptation in a Murine Model of Congenital Obstructive Nephropathy
GSE48344	Pruning of the adipocyte cistrome by hematopoietic master regulator PU.1 (expression)
GSE48345	Pruning of the adipocyte cistrome by hematopoietic master regulator PU.1
GSE48644	Cell death and regenerative proliferation pathways in hepatocellular carcinoma: The effect of furan on B6C3F1 mouse global gene expression in liver
GSE48758	Targeted disruption of BMAL1 in the peripheral reproductive axis results in infertility in female mice
GSE48797	Expression data of mouse developmental T cells (CD4CD8DP, CD4SP and CD8SP) derived from Brd1 deficient thymocyte
GSE48897	Gene expression signatures in Tif1b, Hp1a or Hp1g knockdown hematopoietic progenitors
GSE48929	Gene expression signatures in Tif1b-deficient hematopoietic stem cell
GSE48986	Gene expression changes during hematopoietic cell differentiation
GSE48987	The Tif1Beta-Hp1 system maintains transcriptional integrity of hematopoietic stem cells
GSE49015	Gene expression profiles in islets from pancreatectomized mice
GSE49108	Programmed cell senescence during embryonic development
GSE49254	Impact of conditional autophagy knockout on cytotoxic CD8 T cells at day 7 and day 8 after influenza infection
GSE49461	Development of gene expression signatures for LGR5hi and LGR5lo ISCs in response to gamma-irradiation
GSE49598	ISR target genes revealed by comprehensive microarray network study using Perk -/-, Atf4 -/-, eIF2a S51A mutant, Fv2E-PERK
GSE49643	Development of gene expression signatures for Mmp19 regulation of fibroblast phenotype in mouse lungs
GSE49645	ISR target genes in WAT and BAT of mAP::Fv2E-PERK
GSE49646	The role of ER stress transducer ATF6 in the long bone growth
GSE49647	Saturated fatty acids induced genes and ISR target genes in pancreatic beta cells
GSE50052	Gene expression profiling in murine monocyte-dendritic cell progenitors (MDPs), common monocyte progenitors (cMoPs) and 32Dcl.3 cells transduced with C/EBPalpha and/or IRF8
GSE50149	Quorum sensing in CD4+ T cells homeostasis : IL-2 coordinates the interplay between IL-2p and regulatory T cells.
GSE50206	Induction of pluripotency in human somatic cells via a primitive streak-like state
GSE50221	Cardiac mesenchymal progenitors from postmortem cardiac tissue retained cellular characterization
GSE50458	CSE-induced hydorogen sulfide improves glucose homeostasis and inhibits beta-cell failure in high-fat diet mice
GSE50537	Expression data from RUNX1S291fs-mutant and/or Ezh2 conditional knockout Lineage-c-Kit+Sca-1+ (LSK) cells
GSE50833	Analysis of age-related vascular gene expression in mice
GSE50855	Gene Expression Analysis of Host Immune Responses in CD11b positive cells isolated from lungs of the UV inactivated SARS-CoV-immunized mice following Lethal SARS-CoV Infection
GSE50887	4T1 cells with Control vs SNAIL vs SNAIL/FBXO11
GSE50889	Vector Control vs SNAIL vs SNAIL/FBXO11
GSE51038	Expression data from Sf3b1 heterozygous Lineage-c-Kit+Sca-1+ (LSK) bone marrow cells
GSE51230	Glomerulonephritis in BXSB/MpJ-Yaa mice
GSE51314	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to benz(a)anthracene in lung, liver, and forestomach tissues
GSE51315	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to benzo(b)fluoranthene in lung, liver, and forestomach tissues [BbF]
GSE51316	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to benzo(ghi)perylene in lung, liver, and forestomach tissues [BghiP]
GSE51317	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to benzo(k)fluoranthene in lung, liver, and forestomach tissues [BkF]
GSE51318	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to chrysene in lung, liver, and forestomach tissues [Chr]
GSE51319	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to dibenz(ah)anthracene in lung and forestomach tissues [DBahA]
GSE51320	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to indeno(123,cd)pyrene in lung, liver, and forestomach tissues [IP]
GSE51321	Sub-chronic transcriptional response in adult male MutaTMMouse following oral exposure to 7 individual PAHs in the lung, liver, and forestomach tissues
GSE51466	Polarization profiling of renal macrophages in stone model mice
GSE51636	Gene changes in response to asbestos and carbon nanotube exposure in the pleural cavity, measured using microarrays.
GSE51694	Comprehensive transcriptomic characterization of hepatic expression signatures affected by guanine nucleotide binding protein (G protein) alpha 12 knockout
GSE51819	Low paternal dietary folate alters the sperm epigenome and is associated with negative pregnancy outcomes
GSE51955	Effect of Aid deletion on the global gene expression iPS cells
GSE52273	Effects of hepatocyte-restricted Fra-1 overexpression on hepatic gene expression in High-fat diet (HFD) fed mice
GSE52274	Effects of hepatocyte-restricted Fra-1 overexpression on hepatic gene expression
GSE52275	Regulation of steatohepatitis and PPARg signaling by distinct AP-1 dimers.
GSE52557	Transcriptional profiles of intestinal antigen presenting cells from control, HFD-induced prediabetic and diabetic mice
GSE52558	Transcriptional profiles of intestinal CD4 T-cells from control, HFD-induced prediabetic and diabetic mice
GSE52559	Transcriptional profiles of intestinal APS & CD4-T cells from control, HFD-induced prediabetic and diabetic mice
GSE53030	Exogenous H2S administration does not regulate gene expression in primary murine alveolar type II cells
GSE53132	Der f/SEB-induced skin inflammation
GSE53139	Gene expression regulating the onset of heat-induced intratesticular calcification.
GSE53158	Gene expression in the mouse cerebral cortex exposed to Bisphenol A (BPA) during development.
GSE53237	Gene expression signatures in uteri from nuclear and membrane effects of Estradiol on Estrogen receptor ERα
GSE53444	Gene expression profiling of 4T1-SP and 4T1-NSP cells
GSE53574	Involvement of Nr4a in a Treg-specific transcriptional program and suppression of　Th2/Tfh response
GSE53662	Expression analysis of blastocysts in Kdm4b-PEs
GSE53959	Microarray profiling of gene expression in ageing murine skeletal muscles
GSE54034	Gene expression changes in liver tissues from alcohol treated PPARa-null mice
GSE54078	The effect of BrdU on gene expression profiles of B6C3F1 mice treated with furan
GSE54579	The p53 Signaling Pathway is Activated in Response to Hydroxyurea Embryotoxicity During Organogenesis
GSE54686	Relation between T CD4+: Regulatory cells and IL-2 producing cells
GSE54887	Gene epxression profiling in murine Flt3+ granulocyte progenitors (Flt3+ GPs) and Flt3- granulocyte progenitors (Flt3- GPs)
GSE55262	Expression analysis of DNMT3A mutant-transduced hematopoetic stem/progenitors
GSE55286	Transcriptomic analysis of mouse lung tissue exposed to two multiwalled carbon nanotubes (NRCWE-26 and NM-401)
GSE55443	Candidates for bile acid-dependent PPARα-target genes in mouse intestinal cells
GSE55499	Gene expression in mouse embryonic stem cells trisomic for chromosome 6, 8, 11 and 15
GSE55501	Gene expression and CGH analysis of aneuploid embryonic stem cells
GSE55574	Loss of Tet enzymes compromises proper differentiation of embryonic stem cells
GSE55729	Influence of SB431542 on J1 mouse embryonic stem cells growth
GSE55995	Global murine neutrophil response to highly and less virulent influenza A (H3N2) virus infections at 3 and 9 h post-infection
GSE56159	Effects of PAMAM dendrimers in the mouse brain after a single intranasal instillation
GSE56161	Gene expresson profiles of hPER1S714G and hPER1S714 in liver and white adipose at ZT1 and ZT13
GSE56252	The reprogramming of tumor stroma by HSF1 is a potent enabler of malignancy
GSE57112	Hepatic transcriptome of mice with a deletion of the miR-379/miR-410 cluster at P1
GSE57131	Antibody-based selective isolation of atrial and ventricular cardiomyocytes by differential expression of integrin α6 (CD49f)
GSE57180	Global transcriptional profiles of WT and HOIL-1L-/- BMDMs in response to LPS and TNFa
GSE57373	Taurine transporter (SLC6A6)-deficient skeletal muscle
GSE57424	Dopaminergic subset specification as a model for molecular mechanisms of neural vulnerability in Parkinson's Disease
GSE57798	Influence of DEN in mice liver
GSE57799	Influence of retinol on kidney in 5/6 nephrectomy mice
GSE58003	Gene expression in Bone marrow derived macrophages (BMDM) in the presence or absence of Necrotic cells.
GSE58098	Gene signature of mouse skin resident macrophages
GSE58153	Sox4 links tumor suppression to accelerated aging in mice [Hair regeneration]
GSE58154	Sox4 links tumor suppression to accelerated aging in mice [Telogen]
GSE58155	Sox4 links tumor suppression to accelerated aging in mice
GSE58238	Identification of genes enriched in the Arc, VMH, DMH and LH of adult mouse
GSE58413	Gene expression analysis of CD11b+Gr-1+ myeloid cells and epithelial cells purified from Pten KO prostate tumours
GSE58720	Analysis of the effect of vascular endothelial growth factor on gene expression profile after focal cerebral ischemia in mouse
GSE58735	Global expression profiling of newly derived EpiSC lines
GSE59517	The effects of leptin deficiency on cold-induced energy expenditure
GSE59558	Mouse mammary epithelial and stromal cells: Hormone Treated vs. Vehicle Control
GSE59585	Gene Expression analysis of stomachs of a C/EBP beta knockout (KO) mouse model
GSE59591	Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis
GSE59994	Effects of miR-125b expression on the transcriptome of B cell precursors
GSE60059	Transciptome of ex vivo-isolated Foxp3+/-RORγt+/- CD4+ T cell populations
GSE60345	Gene expression analysis at three different stages of myelination in dorsal root ganglion (DRG) explant cultures isolated from E13.5 C57BL/6J mouse embryos.
GSE60355	Retinoic acid signaling constrains the plasticity of Th1 cells and prevents development of pathogenic Th17 cells [Agilent experiments]
GSE60356	Retinoic acid signaling constrains the plasticity of Th1 cells and prevents development of pathogenic Th17 cells
GSE60406	Gene expression profiling of pancreatic stem cell derived islet like clusters vs native islets
GSE60460	Lateral ventricle SVZ: 3xTg vs WT
GSE60531	Higher maternal folic acid during gestation dysregulates expression of several genes in mice offspring cerebellum
GSE61339	Gene expression profile of the Myd88 gene depletion on mouse salivary glands
GSE61366	Changes in cholesterol homeostasis and acute phase response following pulmonary exposure to multi-walled carbon nanotubes links carbon nanotube exposure to risk of cardiovascular disease
GSE61709	Development of gene expression signatures of murine silicosis in the lung CD45-negative tissue cells from CCR2 knockout mice
GSE62012	CDK6 as key regulator of hematopoietic and leukemic stem cell activation.
GSE62262	Differential expression of mRNAs in naïve, effector, and memory CD8 T cells of mir-150 KO and wild-type mice
GSE62302	Expression data from loss-of-TET2 and/or JAK2V617F mutant Lineage-c-Kit+Sca-1+ (LSK) bone marrow cells
GSE62346	Neonatal morphine exposure alters mRNA and microRNA (miR) expression in mouse hippocampus
GSE62350	Post-natal development of brown adipocytes in white fat: Phases independent and dependent of the ambient temperature
GSE62485	T-bet recruits P-TEFb to super-enhancers to regulate T helper cell differentiation (Agilent 2)
GSE62486	T-bet recruits P-TEFb to super-enhancers to regulate T helper cell differentiation
GSE62653	Gene expression profiling of P53/R26 +/+ (n=2) versus P53/R26-Zeb2tg/tg (n=3) thymic tumors
GSE62662	Genetic background modulates lincRNA-coordinated tissue response to low dose ionizing radiation
GSE62838	Global gene expression analysis of formalin-fixed paraffin-embedded (FFPE), furan-exposed mouse liver using two-colour Agilent microarrays
GSE62840	Global gene expression analysis of formalin-fixed paraffin-embedded (FFPE), furan-exposed mouse liver using one-colour Agilent microarrays
GSE62842	Global gene expression analysis of fresh-frozen, furan-exposed mouse liver using one-colour Agilent microarrays
GSE62843	Global gene expression analysis in paired fresh-frozen and FFPE furan-exposed mouse liver samples
GSE62973	Evaluating the effects of cardiac telomerase re-activation after myocardial infarction in adult mice
GSE63014	Gene expression profiling in wild-type, Irf5-KO, Lyn-KO and Lyn/Irf5-DKO BMDCs unstimulated or stimulated with CpG-B ODN
GSE63299	Colon gene expression signatures in mice mono-associated with IBD-associated micro-organisms
GSE63391	Cancerous inhibitor of Protein Phosphatase 2A promotes B-cell activation in vitro
GSE63847	AKT network of genes and impaired myocardial contractility during murine acute chagasic myocarditis
GSE64473	Color-flu: multi-spectral fluorescent reporter influenza viruses as powerful tools for in vivo studies
GSE64754	Transcriptional profiling of senescent cell-associated genes in adult mouse lung.
GSE64804	Survivin deficient Hepatocellular carcinoma and non-cancerous tissue of mice
GSE64811	Gene expression profiling of resident microglia and invading macrophages
GSE65092	Gene expression profiles of DKO172 cells expressing DICER1 wildtype or hotspot mutants
GSE65188	Gene expression in fetal aortic arteries of C57BL/6 mice with Nod1 stimulation
GSE65289	Polycomb Underlies Transcriptional Heterogeneity in Lineage Priming of Embryonic Stem Cells
GSE65575	Modeling Host Responses to Understand Severe Human Virus Infections
GSE65905	Bacterial c-di-GMP reorganizes hematopoietic stem/progenitors and niches through STING
GSE66126	The p53 Target Gene Siva Enables Tumorigenesis
GSE66572	Analysis of the vascular gene expression profile following a chronic nitrate supplementation in old mice
GSE66812	Toxicogenomic Screen of Replacements for bis(2-ethylhexyl) phthalate (DEHP) Using the Immortalized TM4 Sertoli Cell Line
GSE66875	Circadian regulation of Intellectual Disability genes in the hippocampus, a brain oscillator
GSE66897	Expression data from diseased Ezh2 KO Lineage-c-Kit+Sca-1+ (LSK) bone marrow cells
GSE67406	The basic helix-loop-helix transcription factor Mist1 overexpression in mouse fetal hepatoblast culture
GSE67423	MiR-29a regulates liver fibrosis
GSE67464	Defining the molecular mechanisms underlying immunological memory in T cells (expression)
GSE67465	Defining the molecular mechanisms underlying immunological memory in T cells
GSE67534	Identifying PD0325901-regulated genes in the J1 mESCs
GSE67577	CARD9 impacts colitis by altering gut microbiota metabolism of tryptophan into aryl hydrocarbon receptor ligands
GSE67693	Dermal myogenic precursors derive from muscle satellite stem cells
GSE67726	PHD2/3-dependent hydroxylation of thyroid hormone receptor-α mediates the transcriptional regulation of phospholamban to tune the cardiac response to chronic β-adrenergic stress
GSE67795	Analysis of mir-17~92 targets in motor neurons
GSE68036	Carbon black nanoparticles induce biphasic inflammatory responses in the lungs of C56BL/6 mice following single intratracheal instillation
GSE68202	Gene expression analysis of spinal cord microglia in atopic diathesis model mice.
GSE68208	Analysis of graft-infiltrating CD8+ T cell profile after CD3 antibody therapy
GSE68311	Generation of neural progenitor cells by chemical cocktails and hypoxia
GSE68371	Gene expression analysis of mouse lymphatic endothelial cells (LECs) from the subcapsular sinus (SS, afferent) and lymphatic sinus (LS, efferent)
GSE68415	Loss of TET2 in hematopoietic cells leads to DNA hypermethylation of active enhancers and induction of leukemogenesis [Agilent]
GSE68449	Dual Specificity Phosphatase 1 and Tristetraprolin cooperate to regulate macrophage responses to LPS and dexamethasone
GSE68572	Transcriptional Profiling of Hypoxic Neural Stem Cells to Identify Novel Regulators of Neural Stem Cell Biology
GSE68808	Loss of ATM accelerates pancreatic cancer formation and epithelial–mesenchymal transition
GSE68904	Development of gene sets after deleting Rb and Pten in p53 null background primary prostate cells [Rb and Pten]
GSE68905	Development of gene sets after deleting Rb or Rb and Pten in p53 null background primary prostate cells
GSE68961	Characterization of Anatomical, Macromolecular, and Gene Expression Changes in the Retinal and Retinal Pigmented Epithelium of the nm3342 Mouse: A Potential Model of Serous Retinal Detachment
GSE69019	Characterization of molecular signature in mice that experienced an hostile social environment during cocaine abstinence
GSE69032	Aspp1 Preserves Hematopoietic Stem Cell Pool Integrity and Prevents Malignant Transformation
GSE69260	Histone chaperone CAF-1 is essential for retrotransposon silencing by mediating histone H4K20me3 deposition in mouse preimplantation embryos
GSE69450	Gene expression profile in sciatic nerve from presymptomatic SOD1G93A Amyotrophic Lateral Sclerosis animal model
GSE69498	Expression data from Lineage-c-Kit+Sca-1+ (LSK) and megakaryocyte/erythroid progenitor (MEP) cells isolated from WT, Ezh2Δ/Δ, JAK2V617F, and JAK2V617F/Ezh2Δ/Δ mice
GSE69499	Expression data from Lineage-c-Kit+Sca-1+ (LSK) and megakaryocyte/erythroid progenitor (MEP) cells isolated from JAK2V617F/Ezh2Δ/Δ mice post JQ1 treatment
GSE69500	Understanding the role of EZH2 insufficiency in the pathogenesis of PMF
GSE69536	Gene expression profile in kidney with experimental membranous
GSE69760	Expression data from Bone marrow and Fetal liver Lineage-c-Kit+Sca-1+ (LSK) cells
GSE69824	Catalytically inactive Ring1B maintains near wildtype levels of gene expression in mESCs
GSE69978	Loss of Ring1B catalytic activity causes a pronounced reduction in H3K27me3 deposition yet minimally disrupts the expression of target genes
GSE70023	Expression profile of Ceacam1 downstream genes in NSC and NSCL61
GSE70088	Cardiac adiposity is regulated by Klf4 and c-Myc
GSE70130	Mouse ESC-derived NSPCs NFIA OE (GE)
GSE70131	MicroRNA-153 regulates the acquisition of gliogenic competence by neural stem cells
GSE70329	Genome-wide analysis of Estrogen Receptor-mediated response to acute Estradiol treatment in liver (expression)
GSE70350	Genome-wide analysis of Estrogen Receptor-mediated response to acute Estradiol treatment in liver
GSE70757	ProNGF Drives Localized and Cell Selective Parvalbumin Interneuron and Perineuronal Net Depletion in the Dentate Gyrus of Transgenic Mice: a microarray study in proNGF-overexpressing transgenic mouse
GSE71062	Gene expression analysis of BE(2)C cells treated with SSRP1 and MYCN siRNAs
GSE71105	Gene expression analysis on ganglia derived from TH-MYCN mice
GSE71143	Murine Primary Thymocytes: RadioAdaptive Response (RAR) vs Control
GSE71213	How C/EBPa creates an elite cell state for reprogramming to pluripotency [array]
GSE71218	How C/EBPa creates an elite cell state for reprogramming to pluripotency
GSE71427	Adamts1 Adipocyte Progenitor Cell (APC) expression profile
GSE71822	Allergic Airway Disease is Dependent on Methylene-Tetrahydrofolate Reductase (expression)
GSE71823	Allergic Airway Disease is Dependent on Methylene-Tetrahydrofolate Reductase
GSE71830	Activin/Nodal signaling supports retinal progenitor specification in a narrow time window during pluripotent stem cell differentiation to anterior neuroectoderm
GSE71867	Gene expression in lacrimal gland
GSE71975	Expression profiling reveals transcriptional regulation by Fbxw7/mTOR pathway in radiation-induced mouse thymic lymphomas
GSE72008	Mouse lung tissue transcriptome response to influenza H5N1 and mutants [mRNA](Agilent-028005)
GSE72024	Cre-ERT mediated antiviral induction
GSE72262	Intra-subject correlation of brain and blood gene patterns in a mouse model of depression
GSE72302	MEK and GSK3β inhibition drives ES cells into a naive pluripotent state irrespective of their global methylation status
GSE72334	Transcriptional Response of Male MutaTMMouse Spleen to Dibenzo[def,p]chrysene Exposure
GSE72436	Gene expression profiles upon knocking down Cops2 or Cops5 in mouse embryonic stem cells
GSE72445	Embryonic stem cells culture conditions support distinct ES cell states associated with specific developmental stages and cell types
GSE72767	Effects of miRNA sponge/decoy-mediated reduction of miR-15 family activity on the transcriptome of B cell precursors
GSE72863	Hair follicle aging is driven by transepidermal stem cell elimination via COL17A1 proteolysis
GSE72998	Transcriptome comparison between WT mESC and Tet1,2,3 TKO mESC
GSE73026	Gene expression induced by LPS, two amyloidogenic peptides, Tau 623-628 and Amylin 28-33, in peritoneal macrophages and B1a cells
GSE73050	Investigation of the molecular mechanism of liver regeneration by the multi-omics approach
GSE73298	Global hepatic gene expression data from PPARa liver KO, PPARa liver WT, PPARaKO and WT male mice treated or not with Fenofibrate
GSE73299	Global hepatic gene expression data from PPARa liver KO, PPARa liver WT, PPARaKO and WT male mice fed ad libitum, fasted for 24 hours and re-fed
GSE73306	Gene expression profile of TIARP-deficient macrophages or neutrophils, compared with WT macrophages or neutrophils
GSE73309	Emodin inhibits macrophage alernative activation [Control-IL4-Emodin]
GSE73310	Emodin inhibits macrophage classical activation [Control-LPS-IFNg-Emodin]
GSE73311	Emodin inhibits macrophage alernative activation
GSE73591	Lamin A/C Is Required For ChAT-Dependent Neuroblastoma Differentiation: a microarray gene expression study
GSE73862	A dynamic role of Tbx3 in the pluripotency circuitry
GSE74093	Elevated Hedgehog signalling suppresses DNA damage responses in ageing haematopoietic stem cells
GSE74206	Gene expression patterns from mice hearts with myocardial infarction pretreated with miR-433 inhibition or not
GSE74783	Gene expression in inflammatory macrophages, tissue resident macrophages and neutrophils
GSE75047	Enhanced Phospholipase A2 group 3 expression by oxidative stress decreases the insulin-degrading enzyme
GSE75052	Murine iTreg cells: Control (MIEG3) vs. YY1-expression vector transduced
GSE75072	Microarray analysis of gene expression profile of the spinal cord in the mice L5 spinal nerve ligation model of neuropathic pain
GSE75083	Progranulin Deficiency Promotes Circuit-Specific Synaptic Pruning by Microglia via Complement Activation
GSE75200	Murine bone marrow c-kit+, Sca-1+ lineage neative cells (KSL) from p21CDKN1a-/- vs p21+/+ mice, Flt3/ITD transfected KSL cells and nontransfected KSL cells
GSE75206	Transcriptional Response of Male MutaTMMouse Hippocampus to Benzo[a]pyrene (BaP; CAS no. 50-32-8, now also known as benzo[pqr]tetraphene) Exposure
GSE75399	Gene expression profile of sendai virus infected primary MEFs.
GSE75429	In vivo pulmonary genotoxicity of multiwalled-carbon nanotubes
GSE75532	GFRα1+, NGN3+ and KIT+ spermatogonia of adult mouse testes
GSE76047	Identification of gene expression changes in wild type vs. Pitx2-null cornea.
GSE76255	Cellular dynamics of mouse trophoblast stem cells: Identification of a persistent stem cell type.
GSE76480	Cell-of-origin specific 3D genome structure acquired during somatic cell reprogramming [Expression]
GSE76481	Cell-of-origin specific 3D genome structure acquired during somatic cell reprogramming
GSE76582	Gene expression analysis of mESCs following short-term inhibition with PD032, CHIRON, EPZ6438 and GSK-J4 both individually and in combination.
GSE76693	Transmission of survival signals through Delta-like 1 on activated CD4+ T cells
GSE76944	Microarray analysis of gene expression profile of the inguinal fat in C57BL/6J mice after weight regain
GSE76959	New anti-cancer chemicals Ertredin and its derivatives, regulate oxidative phosphorylation and glycolysis and suppress sphere formation in vitro and tumor growth in EGFRvIII-transformed cells.
GSE77504	Dll1-mediated crosstalk between mammary gland stem cells and their macrophageal niche
GSE77648	GABAA receptors and mother-derived taurine regulate neural progenitor cells specification in the mouse developing cortex
GSE77694	Iron deficiency anemia in mice involves alterations in mitophagy and gene expression in erythroblasts
GSE77777	Response to poly(I:C) in WT and GADD34ΔC/ΔC MEFs
GSE77783	Converting self-renewal in naïve pluripotency to naïve endoderm [I]
GSE77817	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [Brain]
GSE77818	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [Heart]
GSE77819	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [Kidney]
GSE77820	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [Liver]
GSE77821	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [M1-Muscle]
GSE77822	Knockout of Pseudouridine synthase 1 (PUS1) in mice. [M2-Muscle]
GSE77823	Knockout of Pseudouridine synthase 1 (PUS1) in mice.
GSE78144	Comparison of transcriptional profiles between naive, primed and ground state pluripotency in mouse embryonic stem cells of the same genetic background
GSE78890	Brief exposure to small molecules allows induction of mouse embryonic fibroblasts into neural crest-like precursors
GSE79023	Bach2 keeps homeostasis in lung by regulating inflammatory response and maintaining function of alveolar macrophage [array]
GSE79024	Gene expression profiling of Six2-positive nephron progenitors from mouse embryo
GSE79139	Double knockout of Bach1 and Bach2 reveals shared compensatory mechanisms in regulating alveolar macrophage function and lung surfactant homeostasis
GSE79190	The transcriptional profile analysis of mice peritoneal cavity B1a cells from p40-/-CD25-/- mice
GSE79204	The impact of decitabine treatment in MDS-induced Tet2KD/KDEzh2Δ/Δ LSK HSPCs
GSE79206	Acquired resistance to BRAF-inhibitors restores melanoma tumor immune suppression
GSE79322	AP-1 and TEAD4 co-operatively promote the vascular program during hemangioblast specification [expression]
GSE79323	AP-1 and TEAD4 co-operatively promote the vascular program during hemangioblast specification
GSE79397	Effect of LPS and glutathione depletion on gene expression profiling in mouse macrophage-like cells
GSE79515	Gene expression profiles of OSKH iPSCs, OSK iPSCs and ESC
GSE79649	RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells (RIP)
GSE79650	RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells (RNA)
GSE79652	RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells (RNAi)
GSE79655	RISC-mediated control of selected chromatin regulators stabilizes ground state pluripotency of mouse embryonic stem cells
GSE79748	The signaling pathway involved in wild type and 2D2-gut CD4+ T cell development
GSE80065	Gene expression in TAMs
GSE80066	Gene expression in ABHD5-knockdown RAW264.7 cells
GSE80215	N1ICD overexpression effect on white adipose tissue
GSE80420	p38 alpha activates purine metabolism to initiate hematopoietic stem/progenitor cell cycling
GSE80778	Targeting tumor mitochondrial metabolism overcomes resistance to antiangiogenics
GSE80826	Temporal Gene Expression Profiling of Astrocyte Precursors During Development
GSE81052	Comparison of wt, Krt18+/- and Krt18-/- non-tumorous liver tissues at the age of 3, 6 and 12 months [gene expression]
GSE81153	Fetal and neonatal hematopoietic progenitors are functionally and transcriptionally resistant to Flt3-ITD mutations.
GSE81291	Comparison of gene expression in macrophages tolerised by different toll-like receptor ligands
GSE81397	Donor T cells in ovarian graft versus host disease
GSE81435	Modulation of LPS-stimulated BV2 microglial cells by Amauroderma rugosum hexane fraction (HF)
GSE81710	HDAC6 overexpression effect on mouse ESCs
GSE81938	Alternatively activated mononuclear phagocytes from the skin site of infection and the impact of IL-4Rα signaling on CD4+T cell survival in draining lymph nodes after repeated exposure to Schistosoma mansoni cercariae
GSE81943	Hepatic transcriptome of wildtype and Cugbp1 knockout mouse neonates.
GSE82020	Ovol2 expression in germ cells
GSE82044	Expression profiling of dendritic cell (DC) progenitors from Gata2 conditional knockout mice
GSE82053	The Rodent-Specific MicroRNA Cluster within the Sfmbt2 Gene is Imprinted and Essential for Placental Development [mRNA E11.5]
GSE82055	The Rodent-Specific MicroRNA Cluster within the Sfmbt2 Gene Is Imprinted and Essential for Placental Development
GSE82212	Modulation of reactive oxygen species and inflammatory cytokines by FoxO3a promotes host survival against Salmonella typhimurium
GSE83244	Analysis of changes in gene expression in skin epidermis upon conditional knockout of PRC2-subunit Eed
GSE83319	Development of gene expression profiles for murine breast tumours overexpression the transcription factor PRH
GSE83359	Host response in cells from broncho-alveolar lavage (BAL) isolated from mice infected with influenza virus (PR8) and/or Staphylococcus aureus (Newman)
GSE83428	Effect of Nkx2.5 mutation on gene expression profiles of mouse embryonic stem cells undergoing cardiac differentiation.
GSE83502	Genome wide host gene expression analysis in Mice infected with Pasteurella multocida
GSE83599	Comprehensive transcriptome analysis of the cochleae of 7-month-old Fabp7 (+/+) and Fabp7 (-/-) mice
GSE83749	Inhibiting neutrophils activation by long-term administration of 5-amino salicylic acid reduces colitis-associated colorectal tumor burden in ApcMin/+ mice
GSE83891	Tunable regulation of CREB DNA binding activity couples genotoxic stress response and metabolism
GSE83929	Notch2 Expressed by Myofibers Influences Muscle Mass and Fiber Types
GSE84041	Age-Related Gene Expression in mouse liver tissues after exposure to Gamma-ray irradiation
GSE84048	Development of gene expression profiles for murine breast tumours treated with Sunitinib
GSE84075	STAT6-regulated genes in mouse B cells
GSE84509	Gene expression profiling in murine granulocyte-monocyte progenitors (GMP), common dendritic cell progenitors (CDP), committed precursors of classical dendritic cells (pre-cDC), Ly6C+ monocytes (Mo), CD4+ cDC, CD8+ cDC, and neutrophils (Neu)
GSE84512	Tlx1 (Hox11) related gene expression profile after intra-splenic islet transplantation in mice
GSE84744	Impairment of cardiac natriuretic peptide signaling develops the excessive cardiac hypertrophy during lactation period
GSE84771	Gene expression profiling of mouse HSPCs retrovirally transduced with Plzf
GSE85396	Impact of Cugbp1 knockout on skeletal muscle and brain trancsriptome in neonatal mice
GSE85521	Murine Pancreatic Cancer Cells: KLF10 wild type vs KLF10 knockout
GSE85633	Transcriptome characterization of the mouse Lgr5+_MaSCs
GSE85754	Gene expression profiling of FGFR1 KO mice
GSE85808	miR-199a-LCOR axis regulation of mammary gland stem cell and breast cancer stem cell transcriptional programs
GSE85902	Transcriptional profile of Nkx2-5 knockin mutant adult hearts
GSE86074	Effect of cardiomyocyte and vascular smooth muscle cell specific KO of p38 MAPKα on gene expression profile of the heart
GSE86075	Effect of cardiac specific KO of p38 MAPKα on gene expression profile of the heart
GSE86253	Bach Factors Operate Erythro-Myeloid Differentiation by Responding to Infection
GSE86267	Analysing gene expression signatures of whole thymospheres derived from adult (A) or embryonic day 14.5 (E) mouse thymus
GSE86287	Foxo3 drives pathogenic Th1 differentiation
GSE86303	Decreased epithelial Progesterone Receptor A at the window of receptivity is required for preparation of the endometrium for embryo attachment
GSE86349	Atypical chemokine receptor 1 controls haematopoiesis
GSE86588	Transcriptome profile in RAW264.7 cells in response to LPS stimulation
GSE86820	Identification of novel genetic markers for mouse yolk sac cells by using microarray analyses
GSE87302	The Rodent-Specific MicroRNA Cluster within the Sfmbt2 Gene is Imprinted and Essential for Placental Development [mRNA E8.5]
GSE87376	Gene expression profiles of Ecrg4-treated mouse microglia
GSE87600	Salt suppresses IFNγ-inducible chemokines in mouse kidneys with a high-salt condition
GSE87688	Sub-chronic pulmonary transcriptional response to a mixture of 4 PAHs in adult male MutaTMMouse.
GSE87689	Sub-chronic pulmonary transcriptional response to a mixture of 8 polycyclic aromatic hydrocarbons in adult male MutaTMMouse.
GSE87690	Sub-chronic pulmonary transcriptional response to coal tar, a PAH-containing complex mixture, in adult male MutaTMMouse.
GSE87691	Sub-chronic pulmonary transcriptional response to mixtures of polycyclic aromatic hydrocarbons (PAHs)
GSE87781	Retinoic acid-free spheroid culture condition is suitable for growth of TH-MYCN neuroblasts
GSE87782	MYCN-transformed neuroblasts from TH-MYCN mice are selectively isolated and maintained as spheres in vitro
GSE87783	Transcriptomic changes in MYC and PRC2 targets are prominent events in the early pathogenesis of neuroblastoma in TH-MYCN mice
GSE87784	Emerging role of polycomb repressive complex 2 in the early neuroblastoma tumorigenesis in TH-MYCN transgenic mice and its association with human neuroblastoma
GSE87811	Epigenetic stress responses induce muscle stem cell aging by Hoxa9 developmental signals [microarray]
GSE87812	Epigenetic stress responses induce muscle stem cell aging by Hoxa9 developmental signals
GSE88810	Genome-wide analysis of the therapeutic effect of VND3207 on irradiation-induced intestinal injury
GSE88898	Transcript profiling in peritoneal macrophages from wildtype or c-JunΔLysM mice
GSE88900	Comparison of gene expression signatures between Cre- KTC organoid organoid and Cre+ KTC organoid
GSE88920	Dense time series gene expression data from striatum of Huntington’s disease CAG knock-in mice across multiple genetic backgrounds
GSE89007	Nat1 promotes translation of specific proteins that induce differentiation of mouse embryonic stem cells [expression]
GSE89012	Nat1 promotes translation of specific proteins that induce differentiation of mouse embryonic stem cells
GSE89119	Exogenous BAPN administration does not regulate gene expression in primary murine lung fibroblasts and alveolar epithelial type II (ATII) cells.
GSE89121	Exogenous expression of Lox, Loxl1 and Loxl2 regulate gene expression in primary murine lung fibroblasts.
GSE89310	A Homeostatic Shift Facilitates Endoplasmic Reticulum Proteostasis through Transcriptional Integration of Proteostatic Stress Response Pathways [expression]
GSE89311	Inhibition of GGPPS1 attenuated LPS-induced acute lung injury by suppressing the NLRP3 inflammasome
GSE89389	Novel data integration approaches identify concordant and discordant immune responses between mice and humans [mouse]
GSE89392	Novel data integration approaches identify concordant and discordant immune responses between mice and humans
GSE89427	Srf destabilizes cell identity (Microarray_Agilent Technologies)
GSE89555	Early Inhibition of Fatty Acid Synthesis Reduces Generation of Memory Precursor Effector T cells in Chronic Infection
GSE89600	Nat1 promotes translation of specific proteins that induce differentiation of mouse embryonic stem cells [expression 2]
GSE89730	miR-34a negatively regulates alveolarization in a BPD animal model
GSE90034	Srf destabilizes cell identity
GSE90137	Identification of potential target neuronal genes of class I histone deacetylase inhibitor treatment.
GSE90571	Identification of genes regulated by Rb in wild-type and SREBP1 KO MEFs
GSE90577	Cecum gene expression signatures in germ-free WT mice colonized with microbiota from WT or Card9-/- mice and infected with Citrobacter rodentium induced colitis
GSE90881	Identification of receptors involved in hemophagocytosis
GSE91050	Expression analysis of MADM based glioma mouse model
GSE91080	Analysis of gene expression along the Hoxa cluster at five time-points during motor neuron differentiation
GSE92372	Expression profile of P7 control and Lhx2 cKO somatosensory cortex
GSE92476	Expression regulation by Pcgf6 in mouse embryonic stem cells
GSE92552	Gene expression analysis in primary murine Alveolar type II cells under Normoxia 21% O2 and Hyperoxia 85% O2 after 6 hours and 24 hours
GSE92630	Pig testis extract augments the expression and secretion of adiponectin in 3T3-L1 adipocytes
GSE92969	Gene expression changes in wide-type P2X7 overexpressed MLL-AF9 induced mouse acute myeloid leukemia (AML)
GSE93055	Microarray Analyses of Otospheres Derived from the Cochlea in the Inner Ear Identify Putative Transcription Factors that Regulate the Characteristics of Otospheres
GSE93068	Transcriptome characterization of IFNa response in MaSC and luminal progenitor cells
GSE93166	The function of cullin 3 in macrophage
GSE93693	Comprehensive gene expression pattern of developing lens of Foxp1 lens specific knockout mice
GSE93778	Gene expression in Mob1DKO mouse lung
GSE94049	mRNA profiling after Inhibition of the lncRNA Ntep
GSE94522	Depletion of club cells attenuates bleomycin-induced lung injury and fibrosis in mice
GSE94538	Gene expression analysis in naïve and vaccine (peptide vs. DC) primed pmel-1 CD8 Tcells
GSE94727	Elucidation of roles of Nr4a nuclear orphan receptors and Foxp3 in thymic Treg cell development
GSE94750	Gene expression of splenocytes 6 hours after bortezomib or cyclophosphamide injection
GSE95362	Analysis of gene expression in OVA-specific tolerant T cell and naive T cell after stimulation with OVA.
GSE95653	A c-type lectin triggers immune surveillance by innate lymphoid cells for eradication of attaching-and-effacing bacteria.
GSE95655	Expression data from CD4-CD8-(DN) thymic cells isolated from WT, Ezh2Δ/Δ, p53Δ/Δ, and Ezh2Δ/Δp53Δ/Δ mice
GSE96524	Gene expression profiles of E8.75, E9.5, E10.5 and E11.5 ureteric bud precursors
GSE96572	Expression data from skeletal muscles of Ts1Cje and disomic C57BL/6 mice
GSE96588	Development of gene expression for FMDV-infected RAW264.7 cell
GSE97202	Gene expression profiling in Bmi1 knockout innate B-1a cells
GSE97705	Differential innate immune signaling in macrophages by wild type vaccinia virus and mutant virus deleting A26 protein
GSE97918	Microarray transcriptome analysis of primary mouse microglia cells treated with NGF
GSE98325	Expression Signatures of Single Isolated Myofibers of Mouse Hindlimb.
GSE98326	Transcriptional changes induced by over-expression of miR-27a-3p in C2C12 myoblasts.
GSE98327	Transcriptional changes induced by over-expression of miR-142-3p in C2C12 myoblasts.
GSE98328	Expression Signatures of Single Isolated Myofibers of Mouse Hindlimb and miR-27a-3p or miR-142-3p overexpression in C2C12 myoblasts
GSE98500	Functional dissection of hematopoietic stem cell population by a stemness-monitoring system with NS-GFP transgene
GSE98991	Identification of gene targets of the transcription factor SALL4 in undifferentiated spermatogonia
GSE99126	ChAT+ NK cells and ChAT- NK cells expression profile
GSE99141	Adult hepatocytes direct liver organogenesis through non-parenchymal cell recruitment in the kidney
GSE99336	ERF deletion rescues RAS deficiency in mouse embryonic stem cells [expression profiling]
GSE99477	ERF deletion rescues RAS deficiency in mouse embryonic stem cells
GSE99605	Gene expression changes in white adipose tissue from Ing1- and Gadd45a- single- or double-knockout mice
GSE99607	Impaired DNA demethylation of C/EBP sites causes premature aging
GSE100012	Diet-induced changes in gene expression of lean and obese mice in three different brain regions
GSE100219	Ageing-related bladder dysfunctions and their gender differences in mice: in vitro and in vivo functional and gene expression changes
GSE100270	Gene expression profile of ADM, ductal and acinar cells in the setting of pancreatitis
GSE100334	Natural and molecular history of prolactinoma: insights from a Prlr -/- mouse model
GSE100630	Allele-specific genome editing using the CRISPR/Cas9 system phenocopies alopecia areata symptomatic patched hair loss in mice
GSE101725	Gene expression changes in Fbxw11 variants overexpressed in L1210 cell line
GSE101752	Somatic ACE regulates self-renewal of mouse spermatogonial stem cell via MAPK signaling pathway
GSE101959	Immunomodulatory Effects of Yeast Cell Wall Compounds on mouse BMDM
GSE102058	Characteristics and localization of prospective fibroblast subpopulations isolated from the mouse lung
GSE102081	FABP4 overexpressed in intratumoral hepatic stellate cells within hepatocellular carcinoma with metabolic risk factors (part 3)
GSE102083	FABP4 overexpressed in intratumoral hepatic stellate cells within hepatocellular carcinoma with metabolic risk factors
GSE102297	Identification of selective inhibitors for diffuse-type gastric cancer cells by screening of annotated compounds in E-cadherin/p53 double conditional knockout mice
GSE102489	Fatty liver disease caused by high alcohol-producing Klebsiella pneumoniae
GSE102773	Gene expression profiles of embryonic kidneys and reconstructed organoids
GSE102879	Identifying SC1-regulated mRNA and lncRNA in the J1 mESCs
GSE103338	Depletion of Mob1a/b causes intestinal epithelia degeneration by suppressing Wnt and activating BMP/Tgfβ signaling
GSE103598	ALDH high or low cell in 4T1 cell
GSE103750	Impact of TLR7 on Salmonella enterica serovar Typhimurium (STM) infection of bone marrow-derived macrophages (BMDMs)
GSE103982	Bach2 promotes B cell receptor-induced proliferation of B lymphocytes and represses cyclin-dependent kinase inhibitors
GSE104121	Radiation-induced molecular alterations after whole body irradiation in a mouse model
GSE104214	BPIFA1 Regulates Interferon-Mediated Lung Neutrophil Recruitment During Acute Inflammation
GSE104241	Alteration of gene expression by AIMP3 depletion in mouse embryonic stem cells
GSE104494	Gene Expression Regulation by Lung Cancer Oncogenes
GSE104514	Defensive effect of microRNA-200b/c against amyloid-beta peptide-induced toxicity in Alzheimer’s disease models
GSE104625	Signatures of altered gene expression in dorsal root ganglia of a Fabry disease mouse model
GSE104718	mRNA and long noncoding RNA expression microarrays in GM-CSF or GM-CSF+IL6-induced mouse MDSC
GSE104901	Expression data of resident macrophages from the livers of wildtype mice and Melanocortin 4 receptor-deficient (MC4R-KO) mice with non alcoholic steatohepatitis (NASH)
GSE105772	Expression profiles of TIS21/BTG2/PC3 gene knockout in liver of C57BL/6J mice in response to starvation
GSE106108	The gene expression signatures in young and aging C57BL/6 mouse kidney
GSE106375	Cecum and liver gene expression profiles in response to dietary fibre
GSE106425	Ezh2 is essential for activation-induced CD8+ T cell cycle progression via repressing Cdkn1a and Cdkn2c expression (Part II)
GSE106426	Ezh2 is essential for activation-induced CD8+ T cell cycle progression via repressing Cdkn1a and Cdkn2c expression
GSE106533	TGFb treated EpRAS cells undergoing hysteretic vs non-hysteretic EMT gene expression analysis.
GSE106598	Endogenous expression of CD83 in Foxp3+ T cells essentially contributes to differentiation and function of murine Foxp3+ effector regulatory T cells
GSE107141	Development of gene expression signatures on immature B cell for bursal peptide BP9
GSE107317	Microarray analysis of gene expression profiles with or without manipulations of neuronal activity
GSE107326	Oncogenic Kras synergizes with enhanced TGF-beta-Foxd4 signaling to maintain leukemia-initiating cells in acute myeloid leukemia
GSE107364	NEMO is distinct from IKK2 by regulating non-canonical pathway in the experimental nephrotoxic serum nephritis mouse model
GSE107479	The role of macrophage Socs3 in the pathogenesis of aortic dissection
GSE107571	CD40 in thymic DC maturation and Treg cell development
GSE108101	Differential gene expression between TCR-activated CD4+ T cells from control and Gch1;Lck mice
GSE108103	Astrocytes respond to a reduction of extracellular Nerve Growth Factor levels by a phosphorylation of TrkA in the endoplasmic reticulum: a microarray transcriptome study
GSE108289	Mouse DC maturation by LPS
GSE108466	Neurons generated by mouse ES cell with hippocampal or cortical identity display distinct projection patterns when co-transplanted in the adult brain
GSE108629	Gene expression profiles of normal and injured podocytes induced by immunotoxin.
GSE109052	The satellite cell niche regulates the balance between myoblast differentiation and self-renewal via p53
GSE109638	Involvement of B cells, immunoglobulins, and Syk in the pathogenesis of abdominal aortic aneurysm I
GSE109639	Involvement of B cells, immunoglobulins, and Syk in the pathogenesis of abdominal aortic aneurysm II
GSE109640	Involvement of B cells, immunoglobulins, and Syk in the pathogenesis of abdominal aortic aneurysm
... Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here

Data table

SPOT_ID

CONTROL_TYPE

REFSEQ

GB_ACC

GENE

GENE_SYMBOL

GENE_NAME

UNIGENE_ID

ENSEMBL_ID

TIGR_ID

ACCESSION_STRING

CHROMOSOMAL_LOCATION

CYTOBAND

DESCRIPTION

GO_ID

SEQUENCE

(+)E1A_r60_1

pos

(+)E1A_r60_3

pos

(+)E1A_r60_a104

pos

(+)E1A_r60_a107

pos

(+)E1A_r60_a135

pos

(+)E1A_r60_a20

pos

(+)E1A_r60_a22

pos

(+)E1A_r60_a97

pos

(+)E1A_r60_n11

pos

(+)E1A_r60_n9

pos

3xSLv1

neg

A_30_P01017425

FALSE

chr8:119735533-119736887_F

chr8:119736004-119736063

mm|8qE1

lincRNA:chr8:119735533-119736887 forward strand

GACCCTTCCCAGGGTGCCTCATGGTCCGGCTTTCCCTAACAGTCCTTAATTCCCAGAGAT

A_30_P01017426

FALSE

chr10:83325890-83402790_R

chr10:83364773-83364714

mm|10qC1

lincRNA:chr10:83325890-83402790 reverse strand

TCTGATTTTCTTCAGCCACTCCAGGTCCTCACACAGGTTGCTGTCTAGACCATTGGCCAG

A_30_P01017427

FALSE

chr5:30550467-30559008_R

chr5:30558727-30558668

mm|5qB1

lincRNA:chr5:30550467-30559008 reverse strand

TGAAAATCAGTCCCTTCTGATCCATGATGCTTGTGAACCTTGGACTGCCTCGTCAAATTC

A_30_P01017428

FALSE

chr9:88338621-88338923_F

chr9:88338864-88338923

mm|9qE3.1

lincRNA:chr9:88338621-88338923 forward strand

AGTCAACTTAGACAAGTACTAGCAGATTTCCACATAAGAAATCAAACAAGACTTGGGGGA

A_30_P01017429

FALSE

chr18:13114367-13118513_F

chr18:13118138-13118197

mm|18qA1

lincRNA:chr18:13114367-13118513 forward strand

ATCTGAGGTCTGCGACCTGTGATCTTGAGATGTTTCAACTCTTTGAACTGTTCTGGAGAC

A_30_P01017430

FALSE

chr3:85589154-85621215_R

chr3:85621153-85621094

mm|3qF1

lincRNA:chr3:85589154-85621215 reverse strand

CTGAAAGGTGAAGCAAACAAATACAACCCAACAGTGTGCTACTGAAGAAAGCATTCACAG

A_30_P01017431

FALSE

chr11:102983499-102994170_F

chr11:102993470-102993529

mm|11qE1

lincRNA:chr11:102983499-102994170 forward strand

AATTTCCAAGCGCTAAGCTCGAGCTTTCCACGTGCCCAGATCTAGTTGGTCCCAGGGGGA

A_30_P01017432

FALSE

chr2:168804720-168854970_R

chr2:168832661-168832602

mm|2qH3

lincRNA:chr2:168804720-168854970 reverse strand

CTTGTTCAGGTCCCTCTTCTCCTGGCTCCTGAGAGACAGGAAATGGGATAGAAACTACTC

A_30_P01017433

FALSE

chr5:34696192-34722842_F

chr5:34712570-34712629

mm|5qB2

lincRNA:chr5:34696192-34722842 forward strand

AACTGGGATCCCTTTCCCCTTGTGTCCGCCATATTGGACTCTTAACTCTGGTCAGCGGCG