GEO help: Mouse over screen elements for information.
Status
Public on Dec 17, 2012
Title
[miRNA-3] Affymetrix Multispecies miRNA-3 Array
Technology type
in situ oligonucleotide
Distribution
commercial
Organism
synthetic construct Manufacturer
Affymetrix
Manufacture protocol
See manufacturer's web site
Description
#%chip_type=miRNA-3_0 or miRNA-3_1
Submission date
Dec 17, 2012
Last update date
Jul 25, 2018
Organization
Affymetrix, Inc.
E-mail(s)
geo@ncbi.nlm.nih.gov, support@affymetrix.com Phone
888-362-2447
URL
http://www.affymetrix.com/index.affx Street address
City
Santa Clara
State/province
CA
ZIP/Postal code
95051
Country
USA
Samples (3438)
GSM1054922 , GSM1054923 , GSM1054924 , GSM1054925 , GSM1054926 , GSM1054927
GSM1054928 ,
GSM1054929 ,
GSM1054930 ,
GSM1054931 ,
GSM1070624 ,
GSM1070625 ,
GSM1070626 ,
GSM1070627 ,
GSM1070628 ,
GSM1070629 ,
GSM1070630 ,
GSM1070631 ,
GSM1099304 ,
GSM1099305 ,
GSM1099306 ,
GSM1099307 ,
GSM1099308 ,
GSM1099309 ,
GSM1144515 ,
GSM1144516 ,
GSM1144517 ,
GSM1144518 ,
GSM1144519 ,
GSM1144520 ,
GSM1144521 ,
GSM1144522 ,
GSM1144523 ,
GSM1144524 ,
GSM1144525 ,
GSM1144526 ,
GSM1144527 ,
GSM1144528 ,
GSM1144529 ,
GSM1144530 ,
GSM1144531 ,
GSM1144532 ,
GSM1144533 ,
GSM1144534 ,
GSM1144535 ,
GSM1144536 ,
GSM1144537 ,
GSM1144538 ,
GSM1144539 ,
GSM1144540 ,
GSM1173034 ,
GSM1173035 ,
GSM1173036 ,
GSM1173037 ,
GSM1173038 ,
GSM1173039 ,
GSM1173040 ,
GSM1173041 ,
GSM1173042 ,
GSM1173253 ,
GSM1173254 ,
GSM1173255 ,
GSM1173256 ,
GSM1173617 ,
GSM1173618 ,
GSM1173619 ,
GSM1173620 ,
GSM1173621 ,
GSM1173622 ,
GSM1173623 ,
GSM1173624 ,
GSM1173625 ,
GSM1173626 ,
GSM1173627 ,
GSM1173628 ,
GSM1173629 ,
GSM1173630 ,
GSM1173631 ,
GSM1173632 ,
GSM1173633 ,
GSM1173634 ,
GSM1173635 ,
GSM1173636 ,
GSM1173637 ,
GSM1202828 ,
GSM1202829 ,
GSM1202830 ,
GSM1202831 ,
GSM1202832 ,
GSM1202833 ,
GSM1202834 ,
GSM1202835 ,
GSM1202836 ,
GSM1202837 ,
GSM1202838 ,
GSM1202839 ,
GSM1202840 ,
GSM1202841 ,
GSM1202842 ,
GSM1202843 ,
GSM1202844 ,
GSM1202845 ,
GSM1202846 ,
GSM1202847 ,
GSM1211746 ,
GSM1211747 ,
GSM1211748 ,
GSM1211749 ,
GSM1211750 ,
GSM1211751 ,
GSM1211752 ,
GSM1211753 ,
GSM1211754 ,
GSM1223777 ,
GSM1223778 ,
GSM1223779 ,
GSM1223780 ,
GSM1223781 ,
GSM1223782 ,
GSM1223783 ,
GSM1223784 ,
GSM1223785 ,
GSM1223786 ,
GSM1223787 ,
GSM1223788 ,
GSM1223789 ,
GSM1223790 ,
GSM1223791 ,
GSM1223792 ,
GSM1223793 ,
GSM1223794 ,
GSM1223795 ,
GSM1223796 ,
GSM1223797 ,
GSM1223798 ,
GSM1223799 ,
GSM1223800 ,
GSM1231749 ,
GSM1231750 ,
GSM1231751 ,
GSM1231752 ,
GSM1231753 ,
GSM1244195 ,
GSM1244196 ,
GSM1244197 ,
GSM1244198 ,
GSM1244199 ,
GSM1244200 ,
GSM1244201 ,
GSM1244202 ,
GSM1244203 ,
GSM1244204 ,
GSM1244205 ,
GSM1244206 ,
GSM1244207 ,
GSM1244208 ,
GSM1265694 ,
GSM1265697 ,
GSM1265699 ,
GSM1265701 ,
GSM1265703 ,
GSM1265705 ,
GSM1265706 ,
GSM1265708 ,
GSM1265710 ,
GSM1278110 ,
GSM1278111 ,
GSM1278112 ,
GSM1278113 ,
GSM1278114 ,
GSM1278115 ,
GSM1278116 ,
GSM1278117 ,
GSM1278118 ,
GSM1278119 ,
GSM1278120 ,
GSM1278121 ,
GSM1278122 ,
GSM1278123 ,
GSM1278124 ,
GSM1278125 ,
GSM1278126 ,
GSM1278127 ,
GSM1278128 ,
GSM1278129 ,
GSM1278130 ,
GSM1278131 ,
GSM1278132 ,
GSM1278133 ,
GSM1278134 ,
GSM1278135 ,
GSM1278136 ,
GSM1278137 ,
GSM1278138 ,
GSM1278139 ,
GSM1278140 ,
GSM1278141 ,
GSM1278142 ,
GSM1278143 ,
GSM1278144 ,
GSM1278145 ,
GSM1278146 ,
GSM1278147 ,
GSM1278148 ,
GSM1278149 ,
GSM1278150 ,
GSM1278151 ,
GSM1278152 ,
GSM1278153 ,
GSM1278154 ,
GSM1278155 ,
GSM1278156 ,
GSM1278157 ,
GSM1278158 ,
GSM1278159 ,
GSM1278160 ,
GSM1278161 ,
GSM1278162 ,
GSM1290435 ,
GSM1290436 ,
GSM1290437 ,
GSM1290438 ,
GSM1290439 ,
GSM1290440 ,
GSM1290441 ,
GSM1290442 ,
GSM1290443 ,
GSM1290444 ,
GSM1290445 ,
GSM1290446 ,
GSM1290447 ,
GSM1290448 ,
GSM1290449 ,
GSM1290450 ,
GSM1290451 ,
GSM1290452 ,
GSM1290453 ,
GSM1290454 ,
GSM1290455 ,
GSM1290456 ,
GSM1290457 ,
GSM1290458 ,
GSM1290459 ,
GSM1290460 ,
GSM1290461 ,
GSM1290462 ,
GSM1290463 ,
GSM1290464 ,
GSM1290465 ,
GSM1290466 ,
GSM1300429 ,
GSM1300430 ,
GSM1300431 ,
GSM1300432 ,
GSM1300433 ,
GSM1300434 ,
GSM1300435 ,
GSM1300436 ,
GSM1300437 ,
GSM1300438 ,
GSM1300439 ,
GSM1300440 ,
GSM1300441 ,
GSM1300442 ,
GSM1300443 ,
GSM1300444 ,
GSM1300445 ,
GSM1300446 ,
GSM1300447 ,
GSM1300448 ,
GSM1300449 ,
GSM1300450 ,
GSM1300451 ,
GSM1300452 ,
GSM1300453 ,
GSM1300454 ,
GSM1300455 ,
GSM1300456 ,
GSM1300457 ,
GSM1300458 ,
GSM1300459 ,
GSM1300460 ,
GSM1300461 ,
GSM1300462 ,
GSM1300463 ,
GSM1300464 ,
GSM1315846 ,
GSM1315847 ,
GSM1315848 ,
GSM1315849 ,
GSM1315850 ,
GSM1315851 ,
GSM1320380 ,
GSM1320381 ,
GSM1320382 ,
GSM1320383 ,
GSM1320384 ,
GSM1320385 ,
GSM1320386 ,
GSM1320387 ,
GSM1320388 ,
GSM1320389 ,
GSM1320390 ,
GSM1320391 ,
GSM1320392 ,
GSM1320393 ,
GSM1320394 ,
GSM1320395 ,
GSM1320396 ,
GSM1320397 ,
GSM1320398 ,
GSM1320399 ,
GSM1320400 ,
GSM1320401 ,
GSM1320402 ,
GSM1320403 ,
GSM1320404 ,
GSM1320405 ,
GSM1320406 ,
GSM1320407 ,
GSM1320408 ,
GSM1320409 ,
GSM1320410 ,
GSM1320411 ,
GSM1320412 ,
GSM1320413 ,
GSM1320414 ,
GSM1320415 ,
GSM1320416 ,
GSM1320417 ,
GSM1320418 ,
GSM1320419 ,
GSM1320420 ,
GSM1320421 ,
GSM1320422 ,
GSM1320423 ,
GSM1320424 ,
GSM1320425 ,
GSM1320426 ,
GSM1320427 ,
GSM1320428 ,
GSM1320429 ,
GSM1320430 ,
GSM1320431 ,
GSM1320432 ,
GSM1320433 ,
GSM1320434 ,
GSM1320435 ,
GSM1320436 ,
GSM1320437 ,
GSM1320438 ,
GSM1320439 ,
GSM1320440 ,
GSM1320441 ,
GSM1320442 ,
GSM1320443 ,
GSM1327915 ,
GSM1327916 ,
GSM1327917 ,
GSM1327918 ,
GSM1327919 ,
GSM1327920 ,
GSM1327921 ,
GSM1327922 ,
GSM1327923 ,
GSM1327924 ,
GSM1328038 ,
GSM1328039 ,
GSM1328040 ,
GSM1328041 ,
GSM1328042 ,
GSM1328043 ,
GSM1328044 ,
GSM1328045 ,
GSM1328046 ,
GSM1328047 ,
GSM1328048 ,
GSM1328049 ,
GSM1348819 ,
GSM1348820 ,
GSM1348821 ,
GSM1348822 ,
GSM1348823 ,
GSM1348824 ,
GSM1348825 ,
GSM1348826 ,
GSM1348827 ,
GSM1348828 ,
GSM1348829 ,
GSM1348830 ,
GSM1348831 ,
GSM1348832 ,
GSM1348833 ,
GSM1348834 ,
GSM1348835 ,
GSM1348836 ,
GSM1348837 ,
GSM1348838 ,
GSM1348839 ,
GSM1348840 ,
GSM1348841 ,
GSM1348842 ,
GSM1348843 ,
GSM1348844 ,
GSM1348845 ,
GSM1348846 ,
GSM1348847 ,
GSM1348848 ,
GSM1348849 ,
GSM1348850 ,
GSM1348851 ,
GSM1348852 ,
GSM1348853 ,
GSM1348854 ,
GSM1348855 ,
GSM1348856 ,
GSM1348857 ,
GSM1348858 ,
GSM1348859 ,
GSM1348860 ,
GSM1348861 ,
GSM1348862 ,
GSM1348863 ,
GSM1348864 ,
GSM1348865 ,
GSM1348866 ,
GSM1359967 ,
GSM1359968 ,
GSM1359969 ,
GSM1359970 ,
GSM1359971 ,
GSM1359972 ,
GSM1359973 ,
GSM1359974 ,
GSM1359975 ,
GSM1359976 ,
GSM1359977 ,
GSM1359978 ,
GSM1359979 ,
GSM1359980 ,
GSM1359981 ,
GSM1359982 ,
GSM1359983 ,
GSM1359984 ,
GSM1359985 ,
GSM1359986 ,
GSM1359987 ,
GSM1359988 ,
GSM1359989 ,
GSM1359990 ,
GSM1364101 ,
GSM1364102 ,
GSM1364103 ,
GSM1364104 ,
GSM1364105 ,
GSM1364106 ,
GSM1364107 ,
GSM1364108 ,
GSM1373644 ,
GSM1373645 ,
GSM1373646 ,
GSM1373647 ,
GSM1373648 ,
GSM1373649 ,
GSM1373650 ,
GSM1373651 ,
GSM1379507 ,
GSM1379508 ,
GSM1379509 ,
GSM1379510 ,
GSM1379511 ,
GSM1379512 ,
GSM1379513 ,
GSM1379514 ,
GSM1379515 ,
GSM1379516 ,
GSM1379517 ,
GSM1379518 ,
GSM1382232 ,
GSM1382233 ,
GSM1382234 ,
GSM1382235 ,
GSM1382236 ,
GSM1382237 ,
GSM1382238 ,
GSM1382239 ,
GSM1382240 ,
GSM1382241 ,
GSM1382242 ,
GSM1382243 ,
GSM1382244 ,
GSM1382245 ,
GSM1382246 ,
GSM1382247 ,
GSM1382248 ,
GSM1382249 ,
GSM1384608 ,
GSM1384609 ,
GSM1384610 ,
GSM1384611 ...
Accession list truncated, click here to browse through all related public accessions You can also download a list of all accessions here Series (197)
GSE43009 miRNA data in colon mucosa samples from individuals with ulcerative colitis and normal controls
GSE43766 identification of miRNA differential expression patterns in a new model of acquired letrozole resistance
GSE44265 HIV-1 Tat protein promotes neuronal dysfunction through disruption of microRNAs.
GSE45219 MicroRNAs Contribute to iPSC-Somatic Donor Memory
GSE47080 Partial urethra obstruction in rat
GSE48218 Novel critical insights into the mechanism of cell-based therapy after myocardial infarction
GSE48266 Expression data from the rat knee articular cartilage at different developmental stages
GSE49630 miRNA expression data from saliva, blood, semen and vaginal swap
GSE49999 Precursor and mature microRNA expression in MCF7 cells in hypoxia
GSE50574 Adipocyte-derived Exosomal miRNAs from Visceral Adipose Tissue: A Novel Mechanism for Obesity-Related Disease
GSE50885 microRNA expression in heart tissue
GSE50886 microRNA and gene expression profile in ischemia reperfusion injury in heart transplantation
GSE51375 Assesing an improved protocol for plasma microRNA extraction
GSE51730 Profiling the transcriptome: synaptoneurosomes capture the molecular effects of alcohol consumption
GSE52410 Gene expression data of micro RNA from mouse muscle cell line C2C12
GSE52917 Early pre-symptomatic and progressive signatures of non-coding RNAs in ALS patients and mutation carriers
GSE53377 Adipose transcriptome and microRNA profiles after surgery-induced weight loss [miRNA]
GSE53378 Adipose transcriptome and microRNA profiles after surgery-induced weight loss
GSE53771 Molecular regulation of acute kidney injury (miRNA)
GSE53773 Molecular regulation of acute kidney injury
GSE54463 MicroRNA profiling from the silica-induced pulmonary fibrosis mouse model
GSE54639 microRNA (miRNA) expression data from normal human epidermal keratinocytes exposed to sulfur mustard and nitrogen mustard in the presence and absence of hydrocortisone treatment
GSE55012 microRNA cluster 106a~363 is involved in T helper 17 cell differentiation
GSE55013 Profiling of in vitro differentiated activated T helper cells
GSE55025 Expression and incorporation of microRNA in exosomes released by leukemia cells under room air and hypoxia
GSE55937 Cerebrovascular blood microRNA
GSE56368 miRNA profile of the bovine pretransfer endometrium based on pregnancy success after in vivo and in vitro produced embryos transfer
GSE56577 Differential expression of microRNA in Muc2-/- mouse colonic epithelial cells
GSE57042 microRNA expression profile in Leishmania donovani infected mouse macrophage
GSE57321 Sex-specific mRNA and miRNA expression data from Drosophila larvae, pupae and adults [miRNA]
GSE57322 Sex-specific mRNA and miRNA expression data from Drosophila larvae, pupae and adults
GSE57410 MicroRNA expression profile in CHME3 cells infected with Japanese encephalitis virus
GSE57550 miRNA expression profile in HOS cells exposed to sodium fluoride
GSE57647 Time- and phase-dependent expression profile of miRNA and mRNA in human microglial cells (CHME3) infected with Japanese encephalitis virus (JEV) P20778 strain
GSE57713 Temporal Dynamics of Human Cerebrospinal Fluid Vesicle microRNAs
GSE58369 Leishmania major infection-induced changes in the small RNA transcriptome of host macrophages.
GSE58693 MicroRNA (miRNA) expression of IMCD tubule suspension
GSE58730 MicroRNA expression profile of PBMCs in OAD mice and control mice
GSE59359 Prediction of biomarkers for coping styles according to the Mainz Coping Inventory
GSE59398 miRNA profiles in obese and normal weight periodontitis patients
GSE59492 Integrative analysis of microRNA and gene expression profiles identifies microRNAs as potential regulators in alcoholic hepatitis
GSE60615 miRNAs in Treg-derived Exosomes
GSE60962 Alteration of mRNA and microRNA expression profiles in rat muscular type vasculature in early postnatal development [miRNA]
GSE60963 Alteration of mRNA and microRNA expression profiles in rat muscular type vasculature in early postnatal development
GSE61632 Genotoxicity after adeno-associated virus (AAV) gene therapy is dependent upon dose, treatment age and enhancer-promoter selection (microRNA)
GSE61829 Upregulation of Dicer expression by calcitriol induces microRNAs with potential tumor-suppressive effects in cancer cervical cells
GSE62011 A cross-comparison of technologies for the detection of microRNAs from FFPE samples of hepatoblastoma patients [microarray]
GSE62018 A cross-comparison of technologies for the detection of microRNAs from FFPE samples of hepatoblastoma patients
GSE62109 miRNA expression data from CD73-positive Rods, Müler glia and E 17.5 Retinal Progenitors
GSE62367 MicroRNA expression in medulloepitheliomas
GSE62699 Integrating mRNA and miRNA Co-Expression Networks with eQTLs in the Nucleus Accumbens of Human Chronic Alcoholics
GSE62819 MicroRNA Profiling Analysis and Target Gene Prediction in Laryngeal Squamous Cell Carcinoma
GSE63319 miRNA expression data from pediatric high grade gliomas
GSE63762 Differential expression of miRNAs in the GW627368X and PGE2 induced exosomes
GSE64419 Multi-level omics analysis of dystrophin loss and therapeutic restoration in a murine model [microRNA]
GSE64420 Multi-level omics analysis of dystrophin loss and therapeutic restoration in a murine model
GSE64436 Hypoxic MDA-MB-231 miRNA array
GSE64437 Profiling gene and microRNA expression in hypoxic MDA-MB-231 cells
GSE64945 miRNA expression data from mouse fetus ear (pinnae) and back tissues
GSE64989 A possible role of miRNAs as predictive markers for the recurrence of hepatocellular carcinoma after liver transplantation
GSE65208 miRNA expression between CD4+PD1+ and CD4+PD1- T cells
GSE65581 Small ncRNA expression-profiling of blood from Hemophilia A patients identifies miR-1246 as a potential regulator of Factor 8 gene
GSE65978 microRNA data from high-fat diet fed mice with and without exercise
GSE66607 Identification of differently expressed miRNAs between Tamoxifen sensitive cells and Tamoxifen resistant cells
GSE66739 Identifying Non-Invasive Molecular Correlates relevant to Irradiation-Skin Burn Combined Injuries
GSE67886 Deregulated pulmonary growth hormones after intrauterine smoke exposure
GSE67888 Deregulated pulmonary growth hormones after intrauterine smoke exposure
GSE68054 Bowel miRNA expression profiles of infants with gastrointestinal conditions
GSE68451 MicroRNA data in the mouse liver at 48 hrs versus 0 hr post 70% partial hepatectomy
GSE68630 miRNA expression during early, mid and late breast cancer disease progression in mammary glands from MMTV-PyMT transgenic mice
GSE68885 Adipocyte-derived Exosomal miRNAs from Subcutaneous Adipose Tissue: A Novel Mechanism for Obesity-Related Disease
GSE68913 Differential miRNA expression in Cells and Matrix Vesicles in Vascular Smooth Muscle Cells from Rats with Kidney Disease
GSE69910 MicroRNAs defining side population of human malignant mesothelioma cell lines identified by microarray analysis
GSE70026 MicroRNA Expression data from formalin-fixed, paraffin-embedded (FFPE) granulosa cell tumour (GCT) tissue samples
GSE70087 PI3K/AKT/mTOR and Sonic hedgehog pathways cooperate together to inhibit human pancreatic cancer stem cell characteristics and tumor growth
GSE70367 miRNA Expression data from human osteosarcoma (OS)
GSE70415 mRNA and miRNA expression data from human osteosarcoma (OS)
GSE70825 microRNA Expression data from human Ewing's sarcoma (ES)
GSE70827 mRNA and miRNA expression data from human Ewing's sarcoma (ES)
GSE71147 MicroRNA expression profiling in GC-2 cells following 50 Hz ELF-EMF
GSE71172 microRNA expression profiles from three arterial tortuosity syndrome (ATS) patients' skin fibroblasts with recessive SLC2A10 mutations [miRNA]
GSE71537 Alterations in serum microRNA in humans with alcohol use disorders impact cell proliferation and cell death pathways and predict structural and functional changes in brain [miRNA 3.0]
GSE71579 Alterations in serum microRNA in humans with alcohol use disorders impact cell proliferation and cell death pathways and predict structural and functional changes in brain
GSE71962 Urinary miRNA biomarkers for early detection of pancreatic adenocarcinoma (PDAC)
GSE72340 An Investigation of Circulating microRNA Profile in Clinical Cases of Subarachnoid Hemorrhages of Hong Kong
GSE72679 Cancer cell-endothelial intercellular transfer alters the endogenous miRNA profile and phenotype of recipient endothelial cells
GSE74565 MicroRNA screening in human pancreatic carcinoma cell lines
GSE74566 The role of Hoxa9 and Meis1 in development of acute myeloid leukemia
GSE74574 microRNA screening in human pancreatic adenocarcinoma
GSE74753 miRNA expression in inguinal adipose tissues
GSE76591 miRNA expression data from human myocardial infarction hearts
GSE76592 miRNA expression data from the hearts of murine myocardial infarction model
GSE76604 miRNA expression data from the hearts of myocardial infarction model
GSE76673 Expression data of human tympanic membrane cells and epidermal keratinocytes [miRNA]
GSE76674 Expression data of human tympanic membrane cells and epidermal keratinocytes
GSE76839 microRNA expression in Tim-3 knockdown RAW264.7 cell
GSE77378 OBESITY ALTERS MOLECULAR AND FUNCTIONAL CARDIAC RESPONSES TO ISCHEMIA-REPERFUSION AND GLUCAGON-LIKE PEPTIDE-1 RECEPTOR AGONISM
GSE77756 microRNA expression profile from five Ehlers-Danlos Syndrome Hypermobility type/Joint Hypermobility Syndrome (EDS-HT/JHS) patients' skin fibroblasts
GSE77758 Microarray and miRNA expression data from five Ehlers-Danlos Syndrome Hypermobility type/Joint Hypermobility Syndrome (EDS-HT/JHS) patients' skin fibroblasts
GSE79506 miRNA expression data from pancreatic ductal adenocarcinoma (PDAC) cell line BxPC3 and its cisplatin-resistant derivative BxPC3-R
GSE79954 Differential expression of miR-4520a associated with gain-of-function mutations in Familial Mediterranean Fever (FMF)
GSE80198 Gene expression data of micro RNA from skeletal muscle sample of pig breed Duroc and Pietrain with malignant hyperthermia syndrome homozygous negative
GSE81137 microRNA expression profiling in HPV-16/HIV associated Cervical Cancer
GSE81293 Expression of miRNA from lung tissue from Systemic Sclerosis patients with interstitial lung disease (SSc-ILD) and healthy controls.
GSE81294 Lung gene expression
GSE81372 miRNA expression profile analysis in myelodysplastic syndromes
GSE81581 Genomic characterization of liver metastases from colorectal cancer patients [miRNA-3]
GSE81582 Genomic characterization of liver metastases from colorectal cancer patients
GSE81914 microRNA data from atrophied rat gastrocnemius of 5 days post denervation versus sham control
GSE82083 The RGD sequence in fibrillin-1 regulates miRNA expression
GSE82085 The RGD sequence in fibrillin-1 regulates mRNA and miRNA expression
GSE83105 Expression data from Sertoli cells treated with 0.1μM NP, 0.1mM MBP, 0.1μM NP+0.1mM MBP and solvent control
GSE83241 Integrative analysis of pathology, mRNA and microRNA in a polygenic diabetes model, NONcNZO10/LtJ mice
GSE83630 Temporal Changes in MicroRNA Expression in Blood Leukocytes from Patients with the Acute Respiratory Distress Syndrome
GSE83703 MiRNAs regulate dynamic transcriptional changes of broiler embryos in response to modification of the incubation temperature (Musculus pectoralis)
GSE83704 MiRNAs regulate dynamic transcriptional changes of broiler embryos in response to modification of the incubation temperature (Musculus gastrocnemius)
GSE83705 MiRNAs regulate dynamic transcriptional changes of broiler embryos in response to modification of the incubation temperature
GSE83924 miRNA experiment of fresh frozen colonic biopsy samples
GSE84376 Identification miRNA expression profiles of human granulosa cells obtained from PCOS patients and control individuals
GSE85769 Expression and exosome incorporation of microRNA by leukemia versus nonmalignant hematopoietic progenitors
GSE85904 Trichloroethylene-induced miRNA expression changes in B6C3F1 mouse liver
GSE86278 miRNA expression in triple negative tumors
GSE86281 A microRNA signature identifies four subtypes of triple-negative breast cancer II
GSE86948 A microRNA signature identifies four subtypes of triple-negative breast cancer and correlates miR-342-3p as a regulator of the lactate metabolic pathway through silencing the monocarboxylate transporter 1
GSE87553 MiroRNA expression from pig endometrium exposed to developing pre-implantation embryo versus unfertilized oocytes in vivo
GSE87828 In silico characterization of miRNA and long non-coding RNA interplay in multiple myeloma (95 MM miRNA data sets)
GSE87830 In silico characterization of miRNA and long non-coding RNA interplay in multiple myeloma
GSE88870 MicroRNA expression profiling of porcine mammary epithelial cells after challenge with Escherichia coli in vitro
GSE89390 miRNA expression data in MCF-7 breast cancer Cell line post BCAS2 and FST knockdown
GSE90608 MicroRNA expression data from CIE-vapor treated mice
GSE93113 MicroRNA expression data from lymphoblastoid cell lines from patients with bipolar disorder
GSE93114 Gene and MicroRNA expression data from lymphoblastoid cell lines from patients with bipolar disorder
GSE93174 miRNA data in human placentas from normal pregnancies and from pregnancies complicated by SGA and IUGR
GSE93270 Genome-wide profiling of gene (mRNA) amd miRNA expression during mouse embryonic heart development [miRNA]
GSE93271 Genome-wide profiling of gene (mRNA) amd miRNA expression during mouse embryonic heart development
GSE95735 Regulation of microRNA in myositis skeletal muscle after exercise (microRNA)
GSE95790 miRNA Expression data from the uterus of ovariectomized young adult rats treated for three days with E2
GSE96808 Genome-wide profiling of miRNAs during differentiation of wild (WT) murine embryonic stem cells (ESCs), scrambled control (SCR) ESCs, and Strip2 silenced (KD) ESCs
GSE96809 Genome-wide profiling of genes and miRNAs during differentiation of wild (WT) murine embryonic stem cells (ESCs), scrambled control (SCR) ESCs, and Strip2 silenced (KD) ESCs
GSE97274 Gene expression data of microRNA from liver of pig breed German Landrace
GSE97611 Disrupted miRNA expression in HAND
GSE98071 MicroRNAs as Regulators of Aging Processes in the Cochlear Lateral Wall of the Mouse Inner Ear (microRNA data set)
GSE98072 MicroRNAs as Regulators of Aging Processes in the Cochlear Lateral Wall of the Mouse Inner Ear
GSE98406 Comparing miRNA Signature of Colon Cancer Primary Tumors to Metastases Formed in the Liver
GSE98907 Differential expression of miRNA in Tax1BP1 knock-out mice [miRNA]
GSE98909 Differential expression of miRNA and mRNA in Tax1BP1 knock-out mice
GSE100315 Evidence for the importance of post-transcriptional regulatory changes in ovarian cancer progression and the contribution of miRNAs
GSE101067 Comparison of the specificities of the RGG/RG-domains of FMR1, FXR1 and FXR2 for small RNA
GSE103218 MiR-1287-5p has inhibitory effects on breast cancer growth mediated by interaction with phosphoinositide 3-kinase CB
GSE104106 Expression analysis of microRNA by expression microarrays of rectal cancer derived from the Cancer Institute Hospital of Japanese Foundation for Cancer Research.
GSE105124 AltitudeOmics
GSE105416 Gene and microRNA expression data from neuroendocrine transdifferentiated and untreated prostate cancer cell line LNCaP
GSE106527 AltitudeOmics microRNA expression data
GSE106644 Expression data from CTCL patient skin lesion [Affymetrix]
GSE106646 Expression data from CTCL patient skin lesion
GSE106744 In silico characterization of miRNA and long non-coding RNA interplay in multiple myeloma (30 PCL miRNA data sets)
GSE107667 Effects of brain-derived neurotrophic factor on microRNA expression profile in human endothelial progenitor cells
GSE109301 Efficacy of the highly selective focal adhesion kinase inhibitor BI 853520 in adenocarcinoma xenograft models is linked to a mesenchymal tumor phenotype [miRNA]
GSE109304 Efficacy of the highly selective focal adhesion kinase inhibitor BI 853520 in adenocarcinoma xenograft models is linked to a mesenchymal tumor phenotype
GSE111304 Macrophage microRNA-150 promotes pathological angiogenesis as seen in age-related macular degeneration: part I
GSE111323 Macrophage microRNA-150 promotes pathological angiogenesis as seen in age-related macular degeneration
GSE111794 MicroRNA expression data for post-bifurcation internal carotid atheroma
GSE117046 Expression of miRNAs in dorsal rat hippocampus: Effect of subchronic and chronic restraint stress
GSE117666 miRNA expression profiling of the A375 melanoma cell line and its dabrafenib-resistant A375R sub-line.
GSE117739 miRNA expresion data from human induced pluripotent stem cells
GSE118208 miRNA expression profiling in mouse embryonic stem cell conditioned media
GSE118535 The role of miRNA disregulation in the development of HIV associated polyneuropathy
GSE121848 miRNA profiles of exosomes secreted by head and neck cancer-associated fibroblasts and the paired normal fibroblasts
GSE122182 Expression data of miRNA profile from colorectal cancer and the adjacent normal tissues infected with F. nucleatum
GSE127787 17β-estradiol regulates the release of exosomes via miR-1495p and hnRNPA2/B1 in ER+ breast cancer cells
GSE132645 microRNA and mRNA gene expression signature in JK and JinB8 cell lines [miRNA]
GSE132646 microRNA and mRNA gene expression signature in JK and JinB8 cell lines
GSE132822 miRNA Expression data from the differentiating and proliferating neural stem/progenitor cells
GSE132823 miRNA-mRNA networks in depression associated hippocampal remodeling
GSE134984 miR-23a regulates T cellular Redox metabolism in juvenile idiopathic arthritis
GSE136194 miRNA profiling from different histological subtypes of colorectal carcinoma
GSE137590 MiR-145-5p is Down-Regulated in Human Extrahepatic Cholangiocarcinoma and Regulates SRGAP2 and Rac1
GSE137980 AhR activation by TCDD (2,3,7,8-Tetrachlorodibenzo-p-dioxin) attenuates Pertussis toxin-induced inflammatory responses by differential regulation of Tregs and Th17 cells through specific targeting by microRNA
GSE139252 Unique microRNA Alterations in Hepatocellular Carcinomas Arising Either Spontaneously or due to Chronic Exposure to Ginkgo biloba Extract (GBE) in B6C3F1/N Mice
GSE140959 Unique molecular signatures of microRNAs in ocular fluids and plasma in diabetic retinopathy
GSE142239 MiR-543 regulates the epigenetic landscape of myelofibrosis by targeting TET1 and TET2 [miRNA]
GSE142240 MiR-543 regulates the epigenetic landscape of myelofibrosis by targeting TET1 and TET2
GSE142429 Expression data from ex vivo and cultured adipose-derived mesenchymal stromal cells (AdMSC, also known as ASC)
GSE147622 miRNA expression data from bulls with high and low intramusclar fat (IMF) content
GSE148251 MicroRNA profiling in resistance ovarian cell lines
GSE152016 Statin-induced microRNAome alterations in patients with hypercholesterolemia
GSE155746 Ant-leukemic effect of CDK9 inhibition in T-cell prolymphocytic leukemia (microRNA)
GSE156715 miRNA profiling analysis in high-risk intestinal GIST
GSE157061 Genome-wide analysis of differentially expressed miRNAs and their associated regulatory networks in lenses deficient for the congenital cataract-linked tudor domain containing protein TDRD7
GSE161997 Network preservation reveals shared and unique biological processes associated with chronic alcohol abuse in the NAc and PFC [miRNA]
GSE161999 Network preservation reveals shared and unique biological processes associated with chronic alcohol abuse in the NAc and PFC
GSE177066 MicroRNAs dysregulation in experimental interstitial cystitis
GSE181268 Sex-Dependent Changes of miRNA Levels in the Hippocampus of Adrenalectomized Rats Following Acute Corticosterone Administration
GSE181456 miRNA expression analysis of the hippocampus in a vervet monkey model of fetal alcohol spectrum disorder
GSE208228 Expression data from 1. leucine deprivation and 2. ATF4 overexpression on HepG2 cells
GSE239866 MicroRNAs in plasma in metabolic syndrome.
GSE255589 Human Adult Glial Progenitors Express Distinct miRNA Profiles Compared to their Fetal Counterparts
Relations Alternative to
GPL20762
Data table header descriptions ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length Sequence miRNA_ID_LIST SPOT_ID
Data table ID Species Scientific Name Annotation Date Sequence Type Sequence Source Transcript ID(Array Design) Alignments Sequence Length Sequence miRNA_ID_LIST SPOT_ID 14q0_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14q0
chr14:101364257-101364333 (+)
77
TGGACCAATGATGAGACAGTGTTTATGAACAAAAGATCATGATTAATCCAGTTCTGCACAAAACACTGAGGTCCATT
CDBox: 14q0
14qI-1_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-1
chr14:101391158-101391227 (+)
70
AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC
CDBox: 14qI-1
14qI-1_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-1
chr14:101391158-101391227 (+)
70
AAAGTGAGTGATGAATAGTTCTGTGGCATATGAATCATTAATTTTGATTAAACCCTAAACTCTGAAGTCC
CDBox: 14qI-1
14qI-2_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-2
chr14:101393679-101393749 (+)
71
ATAGCCAATCATTAGTATTCTGAGCTGTAGGAATCAAAGATTTTGATTAGATTCTGTAACTCAGAGGTTTA
CDBox: 14qI-2
14qI-3_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-3
chr14:101396256-101396326 (+)
71
TAGACCAATGATGAGTATTCTGGGGTGTCTGAATCAATGATTTTGATTAAACCCTGTAACTCTGAGGTCCA
CDBox: 14qI-3
14qI-4_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-4
chr14:101402828-101402901 (+)
74
TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
CDBox: 14qI-4
14qI-4_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-4
chr14:101402828-101402901 (+)
74
TGGACCAATGATGAGTACCATGGGGTATCTGAAACAGGATTTTTGATTAAACCCATATGCAATTCTGAGGTCCA
CDBox: 14qI-4
14qI-5_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-5
chr14:101404524-101404600 (+)
77
TGGATCAATGATGAGTATTGGTGGAGGTGTCTGAATCAACACTTTTGATTAAGCCCTCTGTGTAACTCTGAGATCTG
CDBox: 14qI-5
14qI-6_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-6
chr14:101405893-101405966 (+)
74
TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
CDBox: 14qI-6
14qI-6_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-6
chr14:101405893-101405966 (+)
74
TGGACCAGTGATGAATATCATGGGGTTTCTGAAACAACATTTTTGATTAAACCCATCTGCAACTCTGAGGTCCA
CDBox: 14qI-6
14qI-7_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-7
chr14:101407463-101407538 (+)
76
TGGATCAATGATGAGTATGCGTGGGGCATCTGAATCAAATATTCTGATTATACCCTGTCTGTATCTCTGAGGTCCA
CDBox: 14qI-7
14qI-8_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-8
chr14:101409788-101409860 (+)
73
TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
CDBox: 14qI-8
14qI-8_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-8
chr14:101409788-101409860 (+)
73
TGGACCAATGATGAGATTGGAGGGTGTCTGAATCAAAAATTTTGATTAAAGCCATCTGTAACTCTGAGGTCCA
CDBox: 14qI-8
14qI-9_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qI-9
chr14:101411986-101412056 (+)
71
TGGATCAATGATGAGTACCCTGGGGTGTCTGAATCTTGGATTTTGATTAAACCCTATAACTCTGAGGTCCA
CDBox: 14qI-9
14qII-10_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-10
chr14:101433389-101433459 (+)
71
AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA
CDBox: 14qII-10
14qII-10_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-10
chr14:101433389-101433459 (+)
71
AAGATCAATGATGACTACTGTTAGTGTATGAGTTACACATGATGAATACATGTCTGAAACTCTGAGGTCCA
CDBox: 14qII-10
14qII-11_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-11
chr14:101434448-101434521 (+)
74
TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-11
14qII-11_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-11
chr14:101434448-101434521 (+)
74
TGGACCAGTGATGGTGACTGGTGGTGTGTGAGTCATGCACAGTGAATATCATGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-11
14qII-12_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-12
chr14:101435285-101435358 (+)
74
TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-12
14qII-12_x_st
Homo sapiens
14-Oct-11
CDBox
Affymetrix Proprietary Database
14qII-12
chr14:101435285-101435358 (+)
74
TGGACCAATGATGACAAATACCGGCGTATGAGTCTTGGATGATGAATAATACGTGTCTGGAACTCTGAGGTCCA
CDBox: 14qII-12
25533 4436 Kbytes .Supplementary file Size Download File type/resource GPL16384_miRNA-3_1-st-v1.annotations.20140513.csv.gz
21.2 Mb
(ftp) (http) CSV
Less...
More...